Pallid-winged grasshopper (Trimerotropis pallidipennis)

Pallid-winged grasshopper (Trimerotropis
pallidipennis)
N omb res comu n es: Chapulín (Español)
Si n ón i mos: Masked grasshopper ( Trimerotropis cincta), Trimerotropis collaris, Trimerotropis coquilletti, Trimerotropis
pilosa , Trimerotropis similis, Trimerotropis vinculata
¿Tienes alguna duda, sugerencia o corrección acerca de este taxón? Envíanosla y con gusto la
atenderemos.
Foto: (c) Patrick Dockens, algunos derechos reservados (CC BY-NC-ND)
Ver todas las fotos etiquetadas con Trimerotropis pallidipennis en Banco de Imagénes »
Descripción de EOL Ver en EOL (inglés) →
Distribution 1
occurs (regularly, as a native taxon) in multiple nations
Migration 1
N on -M i gran t : No. All populations of this species make significant seasonal migrations.
Local l y M i gran t : No. No populations of this species make local extended movements (generally less
than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).
Local l y M i gran t : No. No populations of this species make annual migrations of over 200 km.
Barcode data: trimerotropis pallidipennis 2
The following is a representative barcode sequence, the centroid of all available sequences for this
species.
There is 1 barcode sequence available from BOLD and GenBank.
Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a
member of the species.
See the BOLD taxonomy browser for more complete information about this specimen.
Other sequences that do not yet meet barcode criteria may also be available.
TTAATAATTGGGGCACCAGATATAGCATTCCCACGAATAAACAATATAAGATTCTGACTATTACCACCATCATTAATTTTACTA
-GCCATTTTTTCACTACATTTAGCTGGTATTTCATCAATCCTAGGAGCAGTAAATTTCATTACAACAGCAATTAATATACGATCTG
-GCAATCACAATATTATTAACAGACCGAAATCTAAATACATCATTCTTTGACCCAGCAGGAGGGGGAGACCCAATTCTTTATCA
--GAATCATTTGGAACATTAGGAATAATTTATGCAATACTATCAATTGGACTTATAGGATTTATTGTT
-- end -Download FASTA File
National nature serve conservation status 1
Canada
R ou n d ed N ati on al Statu s R an k : N4 - Apparently Secure
United States
R ou n d ed N ati on al Statu s R an k : N5 - Secure
References
1. © NatureServe, some rights reserved
2. © Barcode of Life Data Systems, some rights reserved