Supresión de la cadherina-E en bovinos preimplantación por ARN de interferencia

MOLECULAR REPRODUCTION AND DEVELOPMENT 73:153–163 (2006)
Targeted Suppression of E-Cadherin Gene
Expression in Bovine Preimplantation
Embryo by RNA Interference Technology
Using Double-Stranded RNA
KORAKOT NGANVONGPANIT, HEIKE MÜLLER, FRANCA RINGS, MARKUS GILLES, DANYEL JENNEN,
MICHAEL HÖLKER, ERNST THOLEN, KARL SCHELLANDER, AND DAWIT TESFAYE*
Institute of Animal Science, Animal Breeding and Husbandry Group, University of Bonn, Endenicher Allee 15,
Bonn, Germany
ABSTRACT
RNA interference (RNAi) has
become acknowledged as an effective and useful tool
to study gene function in diverse groups of cells. We
aimed to suppress the expression of the E-cadherin
gene during in vitro development of bovine preimplantation embryos using RNAi approach. In this experiment the effect of microinjection of E-cadherin and
Oct-4 (as control) double-stranded (ds) RNA on the
mRNA and protein expression level of the target
E-cadherin gene was investigated. For this, a 496 bp
long bovine E-cadherin and 341 bp long Oct-4 dsRNA
sample were prepared using in vitro transcription. In
vitro produced bovine zygotes were categorized into
four treatment groups including those injected with
E-cadherin dsRNA, Oct-4 dsRNA, RNase-free water, and
uninjected controls. While the injection of E-cadherin
dsRNA resulted in the reduction of E-cadherin mRNA
and protein levels at the morula and blastocyst stage,
the transcript and protein product remained unaffected
in the Oct-4 dsRNA, water injected and uninjected
control groups. The relative abundance of E-cadherin
mRNA in the E-cadherin dsRNA injected morula stage
embryos was reduced by 80% compared to the control
group (P < 0.05). The Western blot analysis also
showed a significant decrease in the E-cadherin protein
(119 kDa) in E-cadherin dsRNA injected embryos
compared to the other three groups. Microinjection of
E-cadherin dsRNA has resulted only 22% blastocyst
rate compared to 38%–40% in water injected and
uninjected controls. In conclusion, our results indicated
the suppression of E-cadherin mRNA and protein has
resulted in lower blastocyst rate and the RNAi technology is a promising approach to study the function of
genes in early bovine embryogenesis. Mol. Reprod.
Dev. 73: 153–163, 2006. ß 2005 Wiley-Liss, Inc.
Key Words: RNA interference; bovine embryo;
E-cadherin gene
INTRODUCTION
Despite the fact that the bovine genome has been
recently reported to be completely sequenced, the
ß 2005 WILEY-LISS, INC.
function of most of genes is not yet known. Till recently,
the function of a specific gene in bovine species has been
predicted using knockout experiments conducted in
mouse (Larue et al., 1994; Riethmacher et al., 1995).
However, these knockout technologies are extremely
laborious and need long time to see the effects. To
overcome this, the RNA interference (RNAi) approach
through introduction of sequence specific doublestranded (ds) RNA into the cells has been reported for
the first time in Caenorhabditis elegans (C. elegans) as
an effective tool to study gene function in this species
(Fire et al., 1998). Due to its relatively easy system to
under take and effectiveness, this technique has been
used to study gene function during early embryogenesis
in mammalian species including mouse (Svoboda et al.,
2000; Wianny and Zernicka-Goetz, 2000; Grabarek
et al., 2002; Kim et al., 2002; Stein et al., 2003), pig
(Cabot and Prather, 2003) and most recently in bovine
(Paradis et al., 2005).
The RNAi approach involves cellular regulatory
mechanisms, which is known to be highly conserved
process, and interferes or limits the transcript level by
either suppressing transcription (transcriptional gene
silencing; TGS) or by activating a sequence-specific RNA
degradation process (post transcriptional gene silencing; PTGS). During this process, dsRNA molecules
cleave the inducer molecule into small pieces first
(Bender, 2001; Svoboda, 2004) and eventually destroy
the cellular mRNA molecules, which are called the
target (Bernstein et al., 2001). However, the application
of RNAi in oocytes and preimplantation embryos is
limited to some studies in mouse (Svoboda et al., 2000;
Wianny and Zernicka-Goetz, 2000; Grabarek et al.,
2002; Kim et al., 2002; Stein et al., 2003; Haraguchi et al.,
2004; Lazar et al., 2004; Gui and Joyce, 2005). The first
*Correspondence to: Dawit Tesfaye, PhD, Institute of Animal Science,
University of Bonn, Endenicher Allee 15, Bonn, Germany.
E-mail: tesfaye@itz.uni-bonn.de
Received 5 July 2005; Accepted 11 September 2005
Published online 25 October 2005 in Wiley InterScience
(www.interscience.wiley.com).
DOI 10.1002/mrd.20406
154
K. NGANVONGPANIT ET AL.
report on the possibility of using RNAi to study gene
function in bovine oocytes has been recently reported by
Paradis et al. (2005), where Cyclin B1 gene was targeted
to suppress. Their result showed injection of Cyclin B1
dsRNA resulted in 90% reduction in the amount of
Cyclin B1 mRNA and subsequent reduction in Cyclin B1
protein synthesis. To the best of our knowledge this
study will be the second reporting the application of
RNAi technology in bovine embryos.
Blastocyst formation initiated at compaction and
represented by cell polarization and the onset of cellular
differentiation (Pratt et al., 1982) is mediated by fluid
transfer across the intercellular connections between
the outer blastomeres. During subsequent cavitation,
the blastomeres differentiate into trophectoderm (TE)
and inner cell mass (ICM) cells. In the bovine embryo,
compaction occurs around the 16- to 32-cell stage
(Betteridge and Fléchon, 1988) and is dependent on
the expression of genes regulating cell adhesion and TE
differentiation (Watson et al., 1999). Perturbations in
the expression of genes involved in compaction and
cavitation have been observed in in vitro-produced
bovine morulae and blastocysts compared with their
in vivo counterparts (Wrenzycki et al., 1996, 2001). Ecadherin-mediated cell-to-cell adhesion is associated
with compaction (Pratt et al., 1982; Fleming et al., 1984)
and transcript and protein are reported to be found in
the ICM and TE of expanded bovine blastocysts (Shehu
et al., 1996; Barcroft et al., 1998). Mouse knockout
experiments have shown that E-cadherin null mutants
have never formed normal blastocysts (Larue et al.,
1994; Riethmacher et al., 1995). Similarly, the injection
of E-cadherin dsRNA to the mouse zygote have resulted
in dramatic reduction in mRNA, protein expression and
perturbs the development of the injected embryos
(Wianny and Zernicka-Goetz, 2000). Despite the pre-
dicted role of E-cadherin in the process of compaction,
no information is available on the effect of suppression
of this transcript in the developmental potential of
embryos in bovine. Therefore, in the present study we
aimed to target the bovine E-cadherin gene using
microinjection of sequence specific dsRNA at the zygote
stage and monitor its effect on the mRNA and protein
expression pattern and the developmental potential of
bovine embryos during the later stages.
MATERIALS AND METHODS
Synthesis of DNA Template
For E-cadherin and Oct-4 amplification, pair of primers were designed according to bovine cDNA sequence
found in GenBank (see Table 1 for details) using Primer
Express1 Software v2.0 (Applied Biosystems, Foster
City, CA). These primers generated a PCR amplicon
corresponding to coding sequence and the identity of the
product was confirmed by sequencing. The first round
of PCR amplification was performed using Taq DNA
polymerase (Sigma, St. Louis, MO). At first, the sample
was heated at 958C for 5 min followed by 35 cycles of
denaturing at 948C for 30 sec, annealing at temperatures as indicated in Table 1 for 30 sec and extension
at 728C for 1 min Following the last cycle, a 10 min
elongation step at 728C was performed. The same PCR
conditions have also been used for the second round of
PCR amplification using T7 promoter (GTAATACGACTCACTATAGGG) attached to the 50 -end of each
primer to generate two different templates for in vitro
transcription to produce sense and antisense RNA
strands. These E-cadherin and Oct-4 specific templates
were purified using the QIAquick PCR Purification Kit
(Qiagen, Hilden, Germany).
TABLE 1. Details of Primers Used for dsRNA Preparation and Quantitative Real-Time PCR
GenBank
accession number
Gene
E-cadherina,c
AY508164
E-cadherinb
AY508164
OCT-4a,c
AY490804
OCT-4b
AY490804
b-cateninc
Desmocollin-2
Histone 2ac
a
BT020888
c
M81190
NM_178409
Primer sequences
50 -GTACACCTTCATCGTCCAGAGCTAA-30
50 -GCTCTTCAATGGCTTGTCCATTTGA-30
50 -GTAATACGACTCACTATAGGGGTACACCTTCATCGTCCAGAGCTAA-30
50 -GTAATACGACTCACTATAGGGGCTCTTCAATGGCTTGTCCATTTGA-30
50 -CCCAGGACATCAAAGCTCTTCAG-30
50 -GAACATGCTCTCCAGGTTGCCT-30
50 -GTAATACGACTCACTATAGGGCCCAGGACATCAAAGCTCTTCAG-30
50 -GTAATACGACTCACTATAGGGGAACATGCTCTCCAGGTTGCCT-30
50 -ATTCAGCAGAAGGTCCGAGTGC -30
50 -GTTGAAGCTACTGCCTCCGGTC-30
50 -CGCAACAACTCCGGATGGATAT-30
50 -GGTGGGTAATGCTGGAAACTGC-30
50 -CTCGTCACTTGCAACTTGCTATTC-30
50 -CCAGGCATCCTTTAGACAGTCTTC-30
Primers used for dsRNA preparation.
Primer coupled with T7 promoter used for dsDNA template amplification.
c
Primer used for quantitative real time PCR.
b
Annealing
temperature (8C)
Product size
(bp)
60
496
60
341
60
208
60
238
60
148
RNA INTERFERENCE IN BOVINE EMBRYO
Synthesis of dsRNA
The dsDNA templates coupled with T7 promoter were
in vitro transcribed using RiboMAXTM large scale RNA
Production T7 Systems (Promega, Madison) by which
sense and antisense strands were transcribed from DNA
template in the same reaction (Amdam et al., 2003).
After in vitro transcription, the DNA template was
removed by digestion with RNase-free DNase at 378C for
15 min. Subsequently, the annealing of sense and
antisense RNA strands was performed by incubating
the reaction at 378C for 4 hr after heating to 688C for 4
min to produce the dsRNA (Wianny and Zernicka-Goetz,
2000). Following a phenol/chloroform extraction, the
RNA was precipitated with 0.1 volume of 3 M sodium
acetate (pH 5.2) and 2.5 volume of 100% ethanol. After
centrifugation at 15,000 rpm at 48C for 30 min, the
resulting pellets were washed with 70% ethanol.
Finally, the dsRNA pellets were resuspended in 10 ml
diethylpyrocarbonat (DEPC) treated water. The RNA
concentration was measured by ultraviolet light absorbance using Ultraspec 2100 pro spectrophotometer
(Amersham Biosciences, Buckinghamshire, UK). Both
E-cadherin and Oct4 dsRNA were diluted in DEPC
treated water to obtain a final concentration of 25 mg/ml
and stored at 808C until further use. Two microliters of
the dsRNA and the corresponding dsDNA template were
resolved by electrophoresis on a 2% agarose gel to
evaluate the size and purity of the dsRNA (Fig. 1).
Recovery of Oocytes
Bovine ovaries were obtained from a local slaughter
house and transported to the laboratory in a thermoflask
containing a 0.9% saline solution supplemented with
streptocombin. The cumulus-oocyte complexes (COCs)
were aspirated from follicles (2–8 mm in diameter) with
a 18-gauge needle and COCs with multiple layer of
cumulus cells were selected for in vitro maturation. The
selected oocytes were washed in maturation medium
(MPM, modified Parker medium) supplemented with
15% estrus cow serum (OCS), 0.5 mM L-glutamine,
Fig. 1. Two percent agarose gel stained with ethidium bromide
showing the generation of E-cadherin (496 bp) and Oct-4 (341 bp)
dsRNA compared with DNA template used for in vitro transcription.
155
0.2 mM pyruvate, 50 mg/ml gentamycin sulfate, and
10 ml/ml FSH (Folltropin, Vetrepharm, Canada) before
set into culture. The COCs were cultured in groups of 50
in 400 ml of maturation medium under mineral oil in
four-well dishes (Nunc, Roskilde, Denmark). Maturation was performed for 24 hr at 398C under a humidified
atmosphere of 5% CO2 in air.
In Vitro Fertilization of Oocytes
After maturation, COCs were transferred into fourwell dishes containing 400 ml of fertilization medium
(Fert-TALP) supplemented with 2 mg/ml of heparin
(Sigma), 0.2 mM pyruvate (Sigma) and 25 ml/ml
penicillinamine, hypotaurine, adrenaline (epinephrine)
(PHE). A swim-up procedure has been applied to obtain
motile sperm cell from frozen-thawed semen (Parrish
et al., 1988). Briefly, frozen-thawed sperm cells were
incubated in a tube containing 1.5 ml of sperm-TALP
supplemented with 6 mg/ml BSA and 10 mM pyruvate
for 50 min at 398C in a humidified incubator with 5%
CO2. After this time, the supernatant was recovered and
centrifuged at 250g for 10 min at room temperature to
recover motile sperm cells as pellet. In vitro fertilization
was performed using a final concentration of 2 106
sperm cells/ml in the fertilization drop containing a
group of 50 COCs. Fertilization was initiated during
coincubation of spermatozoa and the matured oocytes
for 20 hr in the same incubator under the same
temperature and atmospheric CO2 content as used for
maturation.
In Vitro Embryo Culture
Following insemination, presumptive zygotes were
stripped off from residual cumulus cells and attached
spermatozoa by vortexing for 90 sec in CR1 culture
medium. Zygotes were grouped into four groups namely:
those to be injected with E-cadherin dsRNA, Oct-4
dsRNA, water, and uninjected controls. After treatment,
zygotes were washed once in fresh culture medium and
cultured in groups of up to 50 zygotes in four-well dishes
each containing 400 ml CR1 medium (Rosenkranz and
First, 1994) until day 7 after insemination. The CR1
medium is supplemented with 10% OCS, 20 ml/ml BME
(amino acids), and 10 ml/ml MEM (nonessential amino
acids) (Gibco BRL, Eggenstein, Germany). Cleavage
rate was assessed 48 hr after insemination, while
morula and blastocyst rate were determined at days 5
and 7 after insemination, respectively. In vitro culture
was also performed in a humidified atmosphere with 5%
CO2 at 398C.
Microinjection of dsRNA
Four groups of 40–50 zygotes were placed into
injection medium [HEPES buffered tissue culture
medium 199 (H-TCM199)] for injection with E-cadherin
dsRNA (group 1), Oct-4 dsRNA (group 2), water (group
3), and uninjected controls (group 4). Microinjection was
performed on an inverted microscope (Leica DM-IRB) at
magnification 200. Zygotes to be injected were placed
in a 10 ml droplet of H-TCM199 under mineral oil.
156
K. NGANVONGPANIT ET AL.
Injection was performed by aspiration the dsRNA into
the 5 mm diameter injection capillary (K-MPIP-3335-5,
Cook, Ireland). The injection volume of 7 pl was
estimated from the displacement of the minisque of
mineral oil in the capillary. After injection all four
groups of zygotes were washed twice in CR1aa medium
and set back into culture. The zygotes were checked for
survival 3–4 hr after injection.
Embryo Collection
Zygotes from all four groups were allowed to develop
until day 7 postinsemination. Day 5 morula and day 7
blastocysts were used for mRNA transcript abundance
and protein expression analysis using real time quantitative PCR and Western blotting, respectively. Prior to
freezing, all embryos were washed two times with PBS
(Sigma) and treated with acidic Tyrode pH 2.5–3
(Sigma) to dissolve the zona pellucida. The zona free
embryos were further washed two times in drops of PBS
and frozen in cryo tubes containing minimal amounts
of lysis buffer [0.8% Igepal (Sigma), 40 U/ml RNasin
(Promega), 5 mM dithiothreitol (DTT) (Promega)].
Embryos for Western blot analysis were additionally
treated with protease inhibitor (Sigma). Until used for
RNA isolation or Western blotting all frozen embryos
were stored at 808C.
RNA Isolation and Reverse Transcription
A total of three pools of each containing 10 embryos
were used for mRNA isolation using oligo(dT)26 attached
magnetic beads (Dynal, Norway, Oslo) following manufacturers instruction. Briefly, embryos in lysis buffer
were mixed with 40 ml binding buffer [20 mM Tris HCl
with pH7.5, 1 M LiCl, 2 mM ethylenediaminetetraacetic
acid (EDTA) with pH 8.0] and incubated at 658C for 5 min
to obtain complete lysis of the embryo and release of
RNA. Ten microlitres of oligo(dT)25 magnetic bead
suspension was added to the samples, and incubated
at room temperature for 30 min. The hybridized mRNA
and Oligo(dT) magnetic beads were washed three times
with washing buffer (10 mM Tris HCL with pH7.5,
0.15 mM LiCl, 1 mM EDTA with pH 8.0). Finally, mRNA
samples were eluted in 12 ml DEPC-treated water and
reverse transcribed in 20 ml reaction volume containing
2.5 mM oligo (dT)12 N (where: N ¼ G, A or C) primer, 4 ml
of 5 first stand buffer (375 mM KCl, 15 mM MgCl2,
250 mM Tris-HCl pH 8.3), 2.5 mM of each dNTP, 10 U
RNase inhibitor (Promega) and 100 U of SuperScript II
reverse transcriptase (Invitrogen, Karlsruhe, Germany).
In terms of the order of adding reaction components,
mRNA and oligo(dT) primer were mixed first, heated to
708C for 3 min, and placed on ice until the addition of
the remaining reaction components. The reaction was
incubated at 428C for 90 min, and terminated by heat
inactivation at 708C for 15 min.
Quantitative Real-Time PCR
Quantification of E-cadherin, Oct-4, and Histone 2a
(H2a) mRNA in the embryos of each treatment group
was assessed by real-time quantitative PCR. Moreover,
two transcripts related to the embryo cell-to-cell adhesion (b-catenin and desmocilin II; DC-II) were quantified
in all four treatment groups in order to determine
the specificity of E-cadherin dsRNA to suppress the Ecadherin mRNA product. The ABI Prism1 7000 apparatus (Applied Biosystems) was used to perform the
quantitative analysis using SYBR1 Green JumpStartTM
Tag ReadyMixTM (Sigma) incorporation for dsDNAspecific fluorescent detection dye. Quantitative analyses
of embryo E-cadherin, Oct-4, b-catenin, and DC-II cDNA
were performed in comparison with H2a as an endogenous control (Robert et al., 2002), and were run in separate wells. PCR was performed by using 2 ml of each
sample cDNA and specific primers which amplify, Ecadherin, Oct-4, b-catenin, DC-II, and H2a. The primer
sequences were designed for PCR amplification according to the bovine cDNA sequence (Table 1) using Primer
Express1 Software v2.0 (Applied Biosystems). Standard curves were generated for both target and endogenous control genes using serial dilution of plasmid
DNA (101 –108 molecules). The PCRs were performed in
20 ml reaction volume containing of 10.2 ml SYBR1
Green universal master mix (Sigma) optimal levels of
forward and reverse primers and 2 ml of embryonic
cDNA. During each PCR reaction samples from the
same cDNA source were run in duplicate to control
the reproducibility of the results. A universal thermal
cycling parameter (initial denaturation step at 958C for
10 min, 45 cycles of denaturation at 958C for 15 sec and
608C for 60 sec) were used to quantify each gene of
interest. After the end of the last cycle, dissociation
curve was generated by starting the fluorescence
acquisition at 608C and taking measurements every
7 sec interval until the temperature reached 958C. Final
quantitative analysis was done using the relative
standard curve method as used in Tesfaye et al. (2004)
and results are reported as the relative expression level
compared to the calibrator cDNA after normalization of
the transcript amount to the endogenous control.
Western Blot Analysis
Groups of 50 embryos at morula (day 5) and blastocyst
(day 7) stage were used for each treatment group, which
include E-cadherin dsRNA injected, Oct-4 dsRNA
injected, water injected and uninjected zygotes. The
proteins were extracted from the embryo in loading
buffer (26% of Tris 1 M pH 6.8, 12% of SDS, 20% of
2-Mercaptoethanol, and 40% of Glycerol). Following
boiling for 5 min, proteins were separated on a 10%
SDS–PAGE gel. Proteins were then transferred onto
nitrocellulose transfer membrane, pore size 0.45 mm
(Protran1, Schleicher & Schuell BioScience, Germany)
using Trans-Blot1 SD; Semi-Dry transfer Cell (Bio-Rad,
CA, USA). The membrane was stained with Ponceau S to
evaluate the transfer quality and blocked for 1 hr in Trisbuffered saline (20 mM Tris pH 7.5, 150 mM NaCl)
containing 0.05% Tween-20 (TBS-T) and 1% Polyvinylpyrolidone (PVP) (Sigma). The membrane was then
RNA INTERFERENCE IN BOVINE EMBRYO
incubated at 48C overnight with the anti-rabbit
E-cadherin primary antibody (Dunn Labotechnik,
Germany). The primary antibody was diluted 1:500 in
TBS-T containing 0.1% PVP prior to use. After incubation with the primary antibody, the membrane was
washed six times for 10 min in TBS-T and the hybridization with the secondary antibody was performed at
room temperature for 1 hr. The secondary antibody,
horseradish-peroxidase-conjugated donkey anti-rabbit
secondary antibody (Amersham Bioscience, UK), was
diluted 1:50,000 in TBS-T containing 0.1% PVP. The
membrane was finally washed six times for 10 min in
TBS-T. The peroxidase activity was detected using
the ECL Plus Western Blotting Detection System
(Amersham Biosciencs) following the manufacturer’s
instructions and visualized using Kodak BioMax XAR
film (Kodak, Japan).
Statistical Analysis
The mRNA expression analysis for studied genes in all
treatment groups and the bovine preimplantation
embryos was analyzed based on the relative standard
curve method. The relative expression data were analyzed using the Statistical Analysis System (SAS) version
8.0 (SAS Institute, Inc., NC) software package. Differences in mean values between two or more experimental
groups or developmental stages were tested using
ANOVA followed by a multiple pairwise comparisons
157
using t-test. Differences of P 0.05 were considered to
be significant.
RESULTS
Temporal Expression Pattern of E-Cadherin,
Oct-4, b-Catenin and Desmocolin II Transcripts
Temporal expression pattern of all four transcripts
namely: E-cadherin, Oct-4, b-catenin, and DC-II, has
been observed during quantification throughout the preimplantation developmental stages of in vitro-produced
bovine embryos (Fig. 2). The E-cadherin mRNA transcript was detected at higher level at immature and
matured oocytes and morula and blastocyts stages
of development. However, transcript abundance was
lower between 2-cell and 16-cell developmental stages.
The Oct-4 transcript was found to be highly abundant at
early developmental stages (between immature oocytes
and four-cell stages) and further down regulated
between eight-cell and morula stages. Relatively higher
transcript abundance was detected at the blastocyst
stage. The expression pattern of b-catenin gene in
in vitro bovine developmental embryos was highly
abundant up to the four-cell stage and further down
regulated in the later stages with a slight increase at the
blastocyst stage. On the contrary, the transcript DC-II
was not detected in earlier developmental stages upto
the 16-cell stage but upregulated slightly at morula and
highly at the blastocyst stage.
Fig. 2. Relative abundance of E-cadherin, Oct-4, b-catenin, and DC-II mRNA in in vitro bovine
preimplantation stage embryos, namely: (immature oocyte IM; mature oocytes MO; 2-cell 2C; 4-cell 4C;
8-cell 8C; 16-cell 16C; morula Mor; blastocyst Bla). The relative abundance of mRNA levels represents the
amount of mRNA compared to the calibrator (16-cell stage) which is set as one. Individual bars show the
treatment mean SD. Values with different superscripts (a,b,c,d,e,f,g) are significantly different
(P ¼ 0.05).
158
K. NGANVONGPANIT ET AL.
The Effect of dsRNA on Embryo
Target mRNA Expression
The results of this mRNA quantification in all four
treatments groups show the injection of the E-cadherin
dsRNA triggered the suppression in the amount of
E-cadherin mRNA in the embryo. As shown in Figure 3,
the relative expression level of E-cadherin mRNA at the
morula stage was found to be reduced by 80% compared
to the uninjected control group (P < 0.01) and 60%
compared to water and Oct4 dsRNA injected group
(P < 0.05). Similarly, the relative abundance of Ecadherin mRNA at the blastocyst stage was lower
(P < 0.01) in the E-cadherin dsRNA injected embryos
compared to the other three groups. As it is shown in
Figure 3, the relative abundance of E-cadherin transcript was lower in both Oct-4 and water injected groups
compared to uninjected control groups at both morula
and blastocyst stages but these differences were not
significant. This shows neither the injection of water nor
Oct-4 dsRNA did significantly affect the expression of
E-cadherin mRNA in both morula and blastocysts stages
of embryo development.
Moreover, quantitative expression analysis of Oct-4
mRNA in morula and blastocyst stages of the four
treatment groups showed the significant effect of the
Oct-4 dsRNA on the expression of the Oct-4 mRNA
compared to the other treatment groups (Fig. 4). The
expression of Oct-4 mRNA in Oct4 dsRNA treated group
was downregulated by 56% at morula and 60% at
blastocyst stages compared to the control group (P <
0.01), while no significant differences in Oct-4 mRNA
were observed between uninjected controls, water
injected and E-cadherin dsRNA injected embryo groups
at both morula and blastocyst developmental stages.
With the aim of investigating the specificity Ecadherin dsRNA in the suppression of the target mRNA,
two functionally related transcripts (b-catenin and
DC-II) and one housekeeping gene H2a were analyzed
for their relative abundance at the blastocyst stages of
all the four treatment groups as shown in Figure 5A–C.
No significant differences (P > 0.05) were observed in
Fig. 3. Relative abundance of E-cadherin mRNA at morula (A) and
blastocyst stage (B) the four treatment groups. The relative abundance
of mRNA levels represents the amount of mRNA compared to the
calibrator (uninjected control), which is set as 1. Individual bars show
the mean SD. Values with different superscripts (a,b) within each
developmental stages (morula and blastocyst) are significantly different (P 0.05).
Fig. 4. The relative abundance of Oct-4 mRNA at morula (A) and
blastocyst stages (B) of embryos in all four treatment groups. The
relative abundance of mRNA levels represents the amount of mRNA
compared to the calibrator (uninjected control). Individual bars show
the treatment mean SD. Values with different superscripts (a,b)
within each developmental stages (morula and blastocyst) are
significantly different (P 0.05).
RNA INTERFERENCE IN BOVINE EMBRYO
159
Fig. 5. The relative abundance of H2a (A), b-catenin (B) and DC-II (C) transcripts at blastocyst stage in
the four treatment groups. The relative abundance of mRNA levels represents the amount of mRNA
compared to the calibrator (uninjected control). Individual bars show the treatment mean SD.
the relative abundance of these three transcripts between the four embryo groups.
Effect of E-cadherin dsRNA on
Protein Expression
To determine the effect of E-cadherin dsRNA on Ecadherin protein expression, Western blot analysis was
performed using proteins extracted from the morula and
blastocyst stages of the four treatment groups namely:
embryos injected with E-cadherin dsRNA, Oct-4 dsRNA,
water and uninjected controls (Fig. 6). Moreover,
in vitro-produced bovine zygote stage embryos before
any treatment were used to assess maternal produced
E-cadherin protein. As shown in Figure 6 below there is a
dramatic decrease in the intensity of E-cadherin protein
band (119 kDa), while the E-cadherin protein band in
Oct-4 dsRNA and water injected groups were similar
with uninjected controls and zygote stage embryos.
Injection of Oct-4 dsRNA and water did not affect the
amount of E-cadherin protein, which is similar with the
amount of E-cadherin protein present in uninjected
control groups. Moreover, the E-cadherin protein
expression at both morula and blastocyst stage were
lower in E-cadherin dsRNA injected embryos compared
to maternal protein in the newly fertilized zygotes before
any microinjection.
Phenotype Assessment Following
Microinjection of dsRNA
The survival rate of the embryos due to injury during
microinjection has been determined 3–4 hr after
microinjection. As it is indicated in Table 2, 15%–20%
of the zygotes did not survive the microinjection procedure due to physical injuries. Within the injected
zygote groups those injected with Oct-4 dsRNA had a
Fig. 6. Western blot analysis for the presence of E-cadherin protein
(119 kDa) in bovine embryo at morula and blastocyst stage following
Oct-4 dsRNA injected, water injected, E-cadherin dsRNA injected
compared to uninjected control and zygote stage embryos prior to
microinjection. (For each treatment, pools of 75 embryos were used
from 3 replicates).
160
K. NGANVONGPANIT ET AL.
TABLE 2. The Phenotypes of Embryo Development Following Treatment With E-cadherin dsRNA, Oct-4 dsRNA,
and Water Compared to the Uninjected Controls
Treatment
E-cad dsRNA inj.
Oct4 dsRNA inj.
Water inj.
Uninj. control
Number of Survival rate of embryos First cleavage
embryos
after microinjection
rate
307
308
326
322
76.64 10.30a
81.80 19.03a,b
74.86 21.23a
98.19 3.03b
71.79 12.57a
69.94 22.69a
81.15 4.72b
81.94 4.12b
Compacted
morula rate
29.29 7.47a
30.62 11.54a,b
40.21 7.83b
38.07 5.72b
Blastocyst rate after Blastocyst/
cavity formation
morula ratio
22.56 9.14a
24.90 16.50a,b
39.77 6.82b
37.57 6.82b
0.77
0.81
0.99
0.99
The difference letter superscripts mean significant difference in same column (P ¼ 0.05).
better survival rate after microinjection compared to the
E-cadherin dsRNA injected and water injected ones.
Only those embryos, which survived the microinjection
procedure were considered for further developmental
data collection. Higher first cleavage rate were observed
in water injected and uninjected controls compared to
those injected with E-cadherin and Oct-4 dsRNA but
these differences are not significant. The compacted
morula and blastocyst rate of injected and uninjected
controls were determined at day 5 and 7 post insemination, respectively. While 22% of E-cadherin and Oct-4
dsRNA injected embryos developed to the morula stage,
27% and 38% were able to reach the morula stage in
water injected and in uninjected control groups, respectively. Similarly, lower percentage of the embryos
injected with E-cadherin (22%) and Oct-4 (25%) dsRNA
developed to the blastocyst stage forming blastocoel
cavity, while 39% and 37% of the embryos injected with
water and uninjected controls, respectively developed to
the blastocyst stage. The blastocyst:morula ratio results
showed that only 77% and 81% of the compacted morula
developed to the blastocyts stage by forming cavitation
in E-cadherin and Oct-4 dsRNA injected embryos,
respectively. However, about 99% of the morula have
developed to the blastocyst stage in water injected and
uninjected control groups.
DISCUSSION
In this study, we have demonstrated that the
introduction of dsRNA into bovine embryos at zygote
stage induced sequence-specific suppression of target
mRNA and lead to post-transcriptional silencing of gene
expression. The efficient introduction of dsRNA is an
important step in getting successful suppression of
transcripts through RNAi. In the present study, microinjection was the technique used to introduce dsRNA
into the embryo. This system has the advantage of being
relatively easy and allows for better control of the amount of dsRNA introduced into the embryo (Svoboda et al.,
2000; Wianny and Zernicka-Goetz, 2000; Paradis
et al., 2005), compared with electroporation (Grabarek
et al., 2002) and transfection technique (Siddall et al.,
2002). However, after microinjection embryos are subjected to a physical injury or stress and some die following injection. This was evidenced by 10% lower survival
rate for microinjected embryos irrespective of the
material injected, compared to the uninjected controls.
Since the effect of microinjection on the survival of the
embryos after injection was similar over the whole
injected groups either with dsRNA or water, influences
by physical injuries during further development were
ruled out.
RNAi has been demonstrated to act by either inducing
degradation of the targeted RNA or inhibiting its
translation, which leads to the loss of function in various
mammalian embryo including mouse (Wianny and
Zernicka-Goetz, 2000; Kim et al., 2002) and pig (Cabot
and Prather, 2003). Our results also showed that the
injection of E-cadherin dsRNA resulted in 80% reduction in the amount of E-cadherin mRNA. These results
are comparable with the results obtained with mouse
oocytes, where a suppression of 80% of Mos and 90% of
Plat mRNA was achieved (Svoboda et al., 2000) and also
in bovine oocytes, where injection of Cyclin B1 dsRNA
has resulted in 90% suppression of Cyclin B1 mRNA
(Paradis et al., 2005). In order to investigate the
specificity of the E-cadherin dsRNA to suppress the
E-cadherin mRNA, two functionally related transcripts
(b-catenin and DC-II) and one housekeeping gene (H2a)
were also quantified at blastocyst stage of the four
treatment groups. Our results have demonstrated that
the injection of E-cadherin dsRNA leads to the specific
degradation of the E-cadherin mRNA with out affecting
the expression of the other functionally related transcripts (b-catenin and DC-II) and the housekeeping gene
studied in this experiment. Moreover, the injection of Ecadherin dsRNA had no effect on the relative abundance
of Oct-4 transcript in all four treatment groups. On the
other hand, the injection of Oct-4 targeted dsRNA
resulted in degradation of the Oct-4 mRNA without
affecting the level of E-cadherin transcript in both
morula and blastocyst stages compared to uninjected
controls. These results are consistent with the results
obtained in bovine oocytes, where the injection of Cyclin
B1 dsRNA has led to degradation of the Cycline B1
mRNA without affecting the mRNA of the housekeeping
gene b-actin and Cycline B2, as member of the Cycline B
family (Paradis et al., 2005). Similar results were also
obtained in the mouse, where the injections of dsRNA
directed toward either Mos or Plat mRNA resulted in the
suppression of the targeted mRNA without affecting the
untargeted transcript abundance (Svoboda et al., 2000).
Our results together with others (Paradis et al., 2005)
indicated that the machinery for RNAi-mediated degradation of targeted mRNA is available and functions in
bovine oocytes and embryos.
RNA INTERFERENCE IN BOVINE EMBRYO
By injection of E-cadherin dsRNA at the zygote stage
we could only degrade the mRNA and disrupt the
protein synthesis from the embryonic genome. As it is
indicated in Figure 6, injection E-cadherin dsRNA has
resulted in the reduction of E-cadherin protein expression at morula and blastocyst stages compared to the
Oct-4 dsRNA and water injected and uninjected controls. Moreover, the level of E-cadherin protein at
morula and blastocyst stages in embryos injected with
E-cadherin dsRNA was lower than in the newly
fertilized zygotes before injection. This residual Ecadherin protein in E-cadherin dsRNA injected embryos
may show persistence of maternally expressed protein.
These results are consistent with the observation made
by Wianny and Zernicka-Goetz (2000) in mouse, where
E-cadherin residues have been detected in at morula
stage embryos injected with E-cadherin dsRNA. Our
immunoblotting results have also showed there is a
decrease in the amount of residual E-cadherin protein detected at the blastocyst stage compared to the
amount detected at the morula stage.
In order to get insight into the expression profile of
genes studied in this study, quantitative real time PCR
was performed throughout the preimplantation developmental stages of in vitro-produced bovine embryos.
E-cadherin transcript as both maternal and embryonic
transcript was detected at immature and matured
oocytes stages and after the activation of embryonic
genome at morula and blastocyst stages. Similarly, Oct4 transcript was detected at higher level in all developmental stages except minimum transcript abundance
between eight-cell and morula stages. Both b-catenin
and DC-II transcripts have shown a temporal expression pattern throughout the preimplantation developmental stages. From their expression pattern it is
possible to suggest that b-catenin is activated from both
maternal and embryonic genome, while DC-II is derived
solely from the embryonic genome. Previous studies on
the mRNA expression of E-cadherin and b-catenin in
bovine preimplantation embryos showed that transcripts were abundant in all stages of development
(Barcroft et al., 1998). In the same study, immunohistological localization of the E-cadherin and b-catenin
protein products showed that they are evenly distributed around the cell margins of one cell zygotes and
cleavage stage embryos. Except some semi-quantitative
RT-PCR analysis of E-cadherin and Oct-4 gene expression between bovine IVP and nuclear transfer embryos
(Park et al., 2004) and E-cadherin and b-catenin
(Barcroft et al., 1998) to the best of our knowledge this
study is the first to show the real-time quantitative
expression profile of these transcripts throughout the
preimplantation stages of in vitro produced bovine
embryos.
Blastocyst formation initiated at compaction and
represented by cell polarization and the onset of cellular
differentiation (Pratt et al., 1982) is mediated by fluid
transfer across the intercellular connections between
the outer blastomeres. In the bovine embryo, compaction occurs around the 16- to 32-cell stage (Betteridge
161
and Fléchon, 1988) and is dependent on the stage
specific expression of genes controlling cell adhesion and
TE differentiation (Watson et al., 1999). Remodeling of
E-cadherin-b-catenin-a-catenin complexes is required
for the rearranging of cadherin-mediated cell–cell
adhesion, the grouping of cells into appropriate structures, and cell migration (MacNeill, 2000). Removal in
the mouse oocyte of the N-terminal part of b-catenin,
containing the binding site for a-catenin and a part of
the binding site for E-cadherin, eliminates blastomere
adhesion (de Vries et al., 2004). In the present study,
various phenotypical data were collected to investigate
the effect of E-cadherin dsRNA injection on further
developmental potential of the embryos. Significant
number of zygotes, about 15%–20%, did not survive the
microinjection procedure due to physical injuries
exerted compared to the noninjected groups. Despite
this microninjection technique is found to be a relatively
easy technique and allows a better control of the amount
of dsRNA injected into each embryo. Even though it is
still significantly lower than the noninjected groups,
zygotes in Oct-4 dsRNA injected group had higher
survival rate than those from E-cadherin dsRNA and
water injected groups. These variations in the survival
of zygotes after microinjection between the three
injected groups may be due to the variation in the
structure of zygotes to withstand any physical injury
during microinjected as in vitro produced oocytes and
zygotes are heterogenous in their nature. To exclude the
effect of these variations in determining the biological
effect of dsRNA on the developmental potential of
embryos, only embryos which survived the microinjection procedure were considered for phenotype data
analysis. However, no significant differences were
observed in the cleavage rate of zygotes survived in the
four treatment groups. Significantly lower morula and
blastocyst rate was observed in E-cadherin and Oct-4
dsRNA injected embryos compared to the water injected and uninjected controls. Taking the proportion of
morula to blastocysts, only 77%–81% of the morula from
E-cadherin and Oct-4 dsRNA injected group developed
to blastocyst stage, while almost all morula in water
injected and uninjected controls developed to blastocyst
stage. Similar observations were also made in mouse
embryos injected with E-cadherin dsRNA, where
embryos developed normally until the compacted morula stage but 70% of these have never formed cavity to
develop to blastocyst stage (Wianny and ZernickaGoetz, 2000). This was consistent with the observation
of studies conducted with E-cadherin null mutant
embryos (Larue et al., 1994; Riethmacher et al., 1995).
Oct-4 is the earliest expressed transcription factor
that is known to be crucial in murine preimplantation
development (Okamoto et al., 1990; Schöler et al., 1990;
Rosner et al., 1990). The mRNA and protein of Oct-4
have been found in murine oocytes and in the nuclei of
subsequent cleavage stage embryos (Schöler et al., 1990;
Rosner et al., 1990; Palmieri et al., 1994), while in the
expanded murine blastocyst stage both mRNA and
protein were predominantly found in the ICM (Palmieri
162
K. NGANVONGPANIT ET AL.
et al., 1994; Pesce et al., 1998; Kirshhof et al., 2000).
However, even in fully expanded bovine and porcine
blastocysts both ICM and TE cells were found to be
positive for Oct-4 protein (Kirshhof et al., 2000). In
the present study, the Oct-4 dsRNA, which is used as
positive control, has resulted in an intermediate effect
on the cleavage and blastocyst rate, that is, higher
compared to the E-cadherin dsRNA injected and lower
than water injected and noninjected control groups.
This low blastocyst rate in Oct-4 dsRNA injected
embryos compared to the water injected and noninjected
controls can be associated on the one hand with the low
cleavage rate, which may be resulted from degradation
of maternal Oct-4 transcript supporting further cleavage of embryos by dsRNA. On the other hand this
phenomenon could be due to unidentified effect of Oct-4
knockdown in bovine embryos on the expression and
activity of other developmentally important transcripts
as it has been observed in lower or non detectable level of
FGF4 in Oct-4/ mouse blastocysts (Nichols et al.,
1998). Moreover, recently, the expression level of
various developmentally important transcripts was
found to be altered in mouse embryos following Oct-4
expression knockdown using dsRNA (Shin et al., 2005).
It has been established that maternal E-cadherin is
present in all stage of mouse embryo (Sefton et al., 1992)
and also, found on the cell surface of unfertilized and
fertilized egg but it is not synthesized in these cells
(Vestweber et al., 1987). Kawai et al. (2002) have shown
the location of E-cadherin protein in embryos using a
laser scanning confocal microscropy, where E-cadherin
protein was distributed uniformly through the cell
surface in normal two-cell embryos. Thus, this is likely
that the E-cadherin protein functions in the compaction
of the morula by cell-to-cell adhesion. As it is observed in
our study and also in the study of Wianny and ZernickaGoetz (2000) that E-cadherin dsRNA injected embryos
have developed normally to the compacted morulae
stage due to the presence of maternal derived Ecadherin protein, which suffices for initial compaction
of the morula (Riethmacher et al., 1995). Moreover, it
has been demonstrated that the compaction is mediated
by microfilaments, microtubules (Pratt et al., 1981;
Winkel et al., 1990), intracellular Ca2þ (Pey et al., 1998),
protein kinase C (Winkel et al., 1990; Ohsugi et al., 1993;
Pauken and Capco, 1999) and E-cadherin (Vestweber
et al., 1987; Takeichi, 1988). In this study, we inactivated only one compaction factor, E-cadherin gene
which may not enough to result in complete loss of
function due to possible compensation of its function by
other functionally related proteins. Therefore, further
study designs, which enable the suppression of mRNA
and proteins of functionally related genes at a time, may
induce a complete loss of function and increase the
efficiency of application of RNAi technology for gene
function analysis.
In conclusion, the microinjection of bovine E-cadherin
dsRNA has resulted in a reduction in the mRNA and
protein expression and subsequent perturbation in
the development of embryos to morula and blastocyst
stages. Moreover, this study has provided convincing
evidence that dsRNA is a power way of interfering with
gene expression and subsequent protein synthesis,
which is an important tool to study the function genes
during early bovine embryo development.
ACKNOWLEDGMENTS
The authors thank Mr. Bernhard Gehrig at Institute
of Animal Physiology, Biochemistry and Hygiene,
University Bonn for technical advice during Western
blot analysis. Embryos were produced at the Animal
Research Station Frankenforst of the Bonn University.
REFERENCES
Amdam GV, Simões ZLP, Guidugli KR, Norberg K, Omholt SW. 2003.
Disruption of vitellogenin gene function in adult honeybees by intraabdominal injection of double-stranded RNA. BMC Biotechnology
3:1.
Barcroft LC, Hay-Schmidt A, Caverney A, Gilfoyle E, Overstrom EW,
Hyttel P, Watson AJ. 1998. Trophectoderm differentiation in the
bovine embryo: Characterization of a polarized epithelium. J Reprod
Fertil 114:327–339.
Bender J. 2001. A vicious cycle: RNA silencing and DNA methylation in
plant. Cell 106:129–132.
Bernstein E, Caudy AA, Hammond SM, Hannon GJ. 2001. Role for a
bidentate ribonuclease in the initial step of RNA interference. Nature
409:363–366.
Betteridge KJ, Fléchon JE. 1988. The anatomy and physiology of preattachment bovine embryos. Theriogenology 29:155–186.
Cabot RA, Prather RS. 2003. Cleavage stage porcine embryos may have
differing developemental requirements for karyopherins a2 and a3.
Mol Reprod Dev 64:292–301.
de Vries WN, Evsikov AV, Haac BE, Fancher KS, Holbrook AE, Kemler
R, Solter D, Knowles BB. 2004. Maternal beta-catenin and Ecadherin in mouse development. Development 131:4435–4445.
Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. 1998.
Potent and specific genetic interference by double-stranded RNA in
caenorhabditis elegans. Nature 391:806–811.
Fleming TP, Warren PD, Chisholm JC, Johnson MH. 1984. Trophectodermal processes regulate the expression of totipotency within the
inner cell mass of the mouse expanding blastocyst. J Embryol Exp
Morphol 84:63–90.
Grabarek JB, Plusa B, Glover DM, Zernicka-Goetz M. 2002. Efficient
delivery of dsRNA into zona-enclosed mouse oocytes and preimplantation embryos by electroporation. Genesis 32:269–276.
Gui LM, Joyce IM. 2005. RNA interference evidence that growth
differentiation factor-9 mediates oocyte regulation of cumulus
expansion in mice. Biol Reprod 72:195–199.
Haraguchi S, Saga Y, Naito K, Inoue H, Seto A. 2004. Specific gene
silencing in the pre-implantation stage mouse embryo by an siRNA
expression vector system. Mol Reprod Dev 68:17–24.
Kawai Y, Yamaguchi T, Yoden T, Hanada M, Miyake M. 2002. Effect of
protein phosphatase inhibitors on the development of mouse
embryos: Protein phosphorylation is involved in the E-cadherin
distribution in mouse two-cell embryos. Biol Pharm Bull 25:179–183.
Kim M-H, Yuan X, Okumura S, Ishikawa F. 2002. Successful
inactivation of endogenous Oct-3/4 and c-mos genes in mouse
preimplantation embryos and oocytes using short interfering RNAs.
Biochem Biophys Res Commun 296:1372–1377.
Kirshhof N, Carnwath JW, Lemme E, Anastassiadis K, Schöler H,
Niemann H. 2000. Expression pattern of Oct-4 in preimplantation
embryos of different species. Biol Reprod 63:1698–1705.
Larue L, Ohsugi M, Hirchenhain J, Kemler R. 1994. E-cadherin null
mutant embryos fail to form a trophectoderm epithelium. Proc Natl
Acad Sci 91:8263–8267.
Lazar S, Gershon E, Dekel N. 2004. Selective degradation of cyclin B1
mRNA in rat oocytes by RNA interference (RNAi). J Mol Endocrinol
33:73–85.
MacNeill H. 2000. Sticking together and sorting things out: Adhesion
as a force in development. Natl Rev Genet 1:100–108.
RNA INTERFERENCE IN BOVINE EMBRYO
Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klebe-Nebenius D,
Chambers I, Schöler H, Smith A. 1998. Formation of pluripotent stem
cells in the mammalian embryo depends on the POU transcription
factor Oct4. Cell 95:379–391.
Ohsugi M, Ohsawa T, Semba R. 1993. Similar responses to pharmacological agents of 1,2-OAG-induced compaction-like adhesion of two-cell
mouse embryo to physiological compaction. J Exp Zool 265:604–608.
Okamoto K, Okazawa H, Okuda A, Sakai M, Muramatsu M, Hamada
H. 1990. A novel octamer binding transcription factor is differentially
expressed in mouse embryonic cells. Cell 60:461–472.
Palmieri SL, Peter W, Hess H, Schöler HR. 1994. Oct-4 transcription
factor is differentially expressed in the mouse embryo during
establishment of the first two extraembryonic cell lineages involved
in implantation. Dev Biol 166:259–267.
Paradis F, Vigneault C, Robert C, Sirard M-A. 2005. RNA interference
as a tool to study Gene Function in bovine oocytes. Mol Reprod Dev
70:111–121.
Park SH, Shin MR, Kim NH. 2004. Bovine oocyte cytoplasm supports
nuclear remodeling but not reprogramming of murine fibroblast
cells. Mol Reprod Dev 68:25–34.
Parrish JJ, Susko-Parrish J, Leibfried-Rutledge ML, Critser ES,
Eyestone WH, First NL. 1988. Bovine in vitro fertilization with
frozen thawed sperm. Theriogenology 25:591–600.
Pauken CM, Capco DG. 1999. Regulation of cell adhesion during
embryonic compaction of mammalian embryos: Roles for PKC and
beta-catenin. Mol Reprod Dev 54:135–144.
Pesce M, Wang X, Wolgemuth DJ, Schöler HR. 1998. Differential
expression of the Oct-4 transcription factor during mouse germ cell
differentiation. Mech Dev 71:89–98.
Pey R, Vial C, Schatten G, Hafner M. 1998. Increase of intracellular
Ca2þ and relocation of E-cadherin during experimental decompaction of mouse embryos. Proc Natl Acad Sci USA 95:12977–12982.
Pratt HP, Chakraborty J, Surani MA. 1981. Molecular and morphological differentiation of the mouse blastocyst after manipulations of
compaction with cytochalasin D. Cell 26:279–292.
Pratt HPM, Ziomek CA, Reeve WJD, Johnson MH. 1982. Compaction of
the mouse embryo: An analysis of its components. J Embryol Exp
Morphol 70:113–132.
Riethmacher D, Brinkmann V, Birchmeier C. 1995. A targeted
mutation in the mouse E-cadherin gene results in defective preimplantation developement. Proc Natl Acad Sci USA 92:855–859.
Robert C, McGraw S, Massicotte L, Pravetoni M, Gandolfi F, Sirard
MA. 2002. Quantification of housekeeping transcript levels during
the development of bovine preimplantation embryo. Bio Reprod 67:
1465–1472.
Rosenkranz CF, First NL. 1994. Effect of free amino acids and vitamins
on cleavage and developmental rate of bovine zygotes in vitro. J Anim
Sci 72:434–437.
Rosner MH, Vigano MA, Ozato K, Timmons PM, Poirier F, Rigby PW,
Staudt LM. 1990. A POU-domain transcription factor in early stem
cells and germ cells of mammalian embryo. Nature 345:686–692.
163
Schöler HR, Dressler GH, Balling R, Rohdewohld H, Gruss P. 1990.
Oct-4: A germline-specific transcription factor mapping to the mouse
t-complex. EMBO J 9:2185–2195.
Sefton M, Johnson MH, Clayton L. 1992. Synthesis and phosphorylation of uvomorulin during mouse early development. Development
115:313–318.
Shehu D, Marsicano G, Fléchon JE, Galli C. 1996. Developmentally
regulated markers of in vitro-produced preimplantation bovine
embryos. Zygote 4:109–121.
Shin MR, Cui XS, Jun JH, Jeong YJ, Kim NH. 2005. Identification of
mouse blastocyst genes that are downregulated by double-stranded
RNA-mediated knockdown of Oct-4 expression. Mol Reprod Dev 70:
390–396.
Siddall LS, Barcroft LC, Watson AJ. 2002. Targeting gene expression in
the preimplantation mouse embryo using morpholino antisense
oligonucleotides. Mol Reprod Dev 63:413–421.
Stein P, Svoboda P, Schultz RM. 2003. Transgenic RNAi in mouse
oocytes: A simple and fast approach to study gene function. Dev Biol
256:187–193.
Svoboda P. 2004. Long dsRNA and silent genes strike back:RNAi in
mouse oocytes and early embryos. Cytogenet Genome Res 105:422–
434.
Svoboda P, Stein P, Hayashi H, Schultz RM. 2000. Selective reduction
of dormant maternal mRNA in mouse oocytes by RNA interference.
Development 127:4147–4156.
Takeichi M. 1988. The cadherins: Cell-cell adhesion molecules controlling animal morphogenesis. Development 102:639–655.
Tesfaye D, Ponsuksili S, Wimmers K, Gilles M, Schellander K. 2004. A
comparative expression analysis of gene transcripts in post-fertilization developmental stages of bovine embryos produced in vitro or in
vivo. Reprod Domest Anim 39:396–404.
Vestweber D, Gossler A, Boller K, Kemler R. 1987. Expression and
distribution of cell adhesion molecule uvomorulin in mouse preimplantation embryos. Dev Biol 124:451–456.
Watson AJ, Westhusin ME, De Sousa PA, Betts DH, Barcroft LC. 1999.
Gene expression regulating blastocyst formation. Theriogenology
51:117–133.
Wianny F, Zernicka-Goetz M. 2000. Specific interference with gene
function by double-stranded RNA in early mouse development. Natl
Cell Biol 2:70–75.
Winkel GK, Ferguson JE, Takeichi M, Nuccitelli R. 1990. Activation of
protein kinase C triggers premature compaction in the four-cell stage
mouse embryo. Dev Biol 138:1–15.
Wrenzycki C, Herrmann D, Carnwath JW, Niemann H. 1996.
Expression of the gap junction gene connexin 43 (Cx43) in
preimplantation bovine embryos derived in vitro or in vivo. J Reprod
Fertil 108:17–24.
Wrenzycki C, Herrmann D, Keskintepe L, Martins A, Jr, Sirisathien S,
Brackett B, Niemann H. 2001. Effects of culture system and protein
supplementation on mRNA expression in pre-implantation bovine
embryos. Hum Reprod 16:893–901.