Capítulo 9. Discusión general

Editor: Editorial de la Universidad de Granada
Autor: María de las Mercedes Ruiz Estévez
D.L.: GR 890-2014
ISBN: 978-84-9028-937-2
El presente trabajo se ha realizado en el
Grupo de Genética Evolutiva
del
Departamento de Genética de la Universidad
de Granada. La investigación ha sido
financiada por el Ministerio de Ciencia e
Innovación a través del proyecto CGL200911917 y parcialmente realizada con fondos
FEDER.
Durante la realización de este proyecto de
Tesis Doctoral he disfrutado de una Beca
Predoctoral de Formación del Personal
Universitario (FPU), del Ministerio de
Ciencia y Tecnología, con la siguiente
referencia: AP2007-00348.
A mis padres Tomás y Mercedes, a mi hermana Marta
A Karl
y…
A todos los que me apoyaron durante todos estos años
Agradecimientos
Parece que fue ayer cuando empecé la Tesis Doctoral, pero parece también un día lejano
cuando me pongo a pensar en pequeños detalles del día a día. A lo largo de estos 5 años
he pasado por muuuuchos momentos buenos, pero también muchos momentos duros, en
los que los resultados no salen o los experimentos no van lo bien que, en tu mente
habías, planeado. Han sido momentos de sonrisas y lágrimas, alegrías y tristezas, y
muchísimas noches las que he soñado con esta bendita Tesis Doctoral. Ahora que se
acerca el final, la alegría que siento hace que todo lo malo se borre de la mente, y si
tuviera que empezar de nuevo esta Tesis, aceptaría con los ojos cerrados.
No podría imaginar un grupo de investigación mejor para desarrollar mi Tesis Doctoral.
En estos 5 años he entrado a formar parte de “una familia” en la que me he sentido muy
cómoda y feliz, a la vez que arropada en todos los sentidos. Grupos como éste hay
pocos, y por eso les doy las gracias por ser como son.
En primer lugar quería agradecer al Dr. Juan Pedro Martínez Camacho y a la Dra. Mª
Dolores López-León el haber sido unos directores de tesis excepcionales. Me siento
muy orgullosa de ellos porque son imparables, incansables y siempre están detrás de un
ordenador (sábados y domingos incluidos) para responder a mis preguntas. Nunca me
han dejado sola, me han ayudado, aconsejado, “dado caña” cuando había que hacerlo y,
sobre todo, me han enseñado a pensar de una manera autocrítica en el trabajo que
desarrollo, a no conformarme y mirar más allá, a tener inquietudes propias de un
investigador….en resumen, me han formado como científica.
También quiero agradecer a la Dra. Josefa Cabrero Hurtado el haber sido una parte
importante de su proyecto, y es que la considero una tercera directora de esta Tesis.
Gracias por ayudarme siempre, aconsejarme en los diferentes experimentos, enseñarme
el mundo de la citogenética, hablarme siempre desde el lado práctico, y ayudarme a que
no empeoraran mis dolores de espalda fruto de cientos de horas en el microscopio,
prestándome “tu cojín”. Y es que esto es solo un ejemplo de que te has comportado
conmigo siempre como una madre, y sé que hablo por mi madre Mercedes también
cuando digo que “gracias”.
Por otro lado, no puede faltar mi especial agradecimiento a la Dra. y amiga Eli Montiel.
Ella fue la que me enseñó el mundo del laboratorio cuando llegué a este grupo, me
enseñó a PeCeeRrear como una loca, a analizar resultados, y a empezar a ser crítica. Mi
iniciación en este mundo la asocio a ti, así que muchas gracias por tu paciencia y tus
ganas, siempre dispuesta a ayudarme con lo que fuera. También quiero darle las gracias
a mi amiga Tati López. Para mí siempre serás nuestra técnico y por supuesto, la mejor.
Gracias por enseñarme cosas del laboratorio, ayudarme, cuidar mis saltamontes cuando
yo no estaba, pero sobre todo, por recibirme cada mañana con energía, vitalidad, una
sonrisa, ganas de trabajar, cosas que contar, por llevarme a tu casa y hacerme sentir
parte de tu familia, ayudarme a hacer la mudanza, llevarme con tus amigas al Aquaola,
etc etc etc…Has sido durante estos 5 años una gran amiga (y lo seguirás siendo) y te he
9
echado muchísimo de menos estos últimos meses. Ojalá vuelvas pronto porque tú vales
lo que no está escrito. Continúo con Paquillo, “el crack”. Has estado siempre ahí
dispuesto a ayudarme, aunque supusiera dejar de hacer tus cosas. Poco a poco te has ido
convirtiendo en un gran amigo, y así las Tesis se hacen mejor. Gracias por las risas y
conversaciones que nos echamos, por tu forma de ser, por las comidas en los
comedores, por hacerme la guía turística de tu pueblo, por darme bollos de tu madre,
por ayudarme con cualquier programa/problema informático y por compartir conmigo
grandes momentos fuera del laboratorio, como los “hashs” que hemos corrido por
Granada, las cenas que hemos hecho en mi casa (acompañadas de los partidos de “beerpong”, que hasta para eso eres un crack!), las barbacoas, el partido de frisbee en Plaza
de Gracia…Son muchos buenos recuerdos, así que gracias por contribuir a que estos
años fueran muy buenos. También quiero agradecer a mi amiga y compañera Bea
Navarro su aportación a la presente Tesis. Gracias por compartir conmigo parte de estos
momentos, darme consejos, animarme, hacerme preguntas que me incitan a pensar más
allá de lo que yo creía, compartir conmigo tus inquietudes y aspectos personales. Tú
también me has metido en tu grupo de amigas y me has llevado tanto al campo como a
la montaña, así que has hecho que los días de esta Tesis sean más alegres. Gracias.
Continúo agradeciendo a Rubén Martín su granito de arena a esta Tesis. Llegaste el
último, por lo que hemos compartido menos momentos, pero no menos importante.
Gracias por tu humor y tu sentido práctico de las cosas, por mostrar interés en qué
estaba pasando por mi cabeza, y por apartar tu vista del ordenador en un segundo cada
vez que te preguntaba una duda.
Agradezco al Dr. Francisco Perfectti todas sus aportaciones a la presente Tesis. Tu ojo
estadístico, consejos y ayuda me han facilitado mucho las cosas. Así que una parte
importante de esta Tesis también se la debo a él. También le agradezco al Dr.
Mohammed Bakkali la ayuda que me ha brindado en todo momento, sus consejos, ser
tan directo a la hora de decir las cosas, las bromas que hemos tenido, haberme llamado
cuando tuve que ir al hospital, y también haberme “mentido” cuando le pregunté
gritando “¿estoy sangrando?”, tras haberme explotado un termo con nitrógeno líquido
en toda la oreja. Evitaste que me desmayara en ese momento. No podía olvidarme de la
Dra. María Teruel. Ella es otra persona, y además amiga, importante en mi iniciación en
el laboratorio. Cuando yo entraba tú casi salías, pero me enseñaste a organizarme, a no
parar de trabajar con cabeza y a que había que llegar a las 4 de la tarde a continuar
trabajando tras el almuerzo. Gracias por enseñarme muchas cosas teóricas y prácticas,
gracias por querer que fuera yo la que me quedara con tu puesto del lab cuando tú te
fueras, y gracias por enseñarme que si quería hacer una tesis tenía que ser fuerte para
superar el gran reto que es. Y es que aún recuerdo que tú escribías la tesis cuando yo
prácticamente acababa de llegar, y viéndote sabía que esto no iba a ser fácil. Me armé
de fuerzas y dije: “Yo puedo con esto”. Gracias. Mis agradecimientos también van para
la Dra. Inma Manríquez, con la que compartí muchos momentos en el lab, y con la que
competía a ver quién hablaba más y más alto, jeje. Pasamos buenos momentos y
entablamos una amistad que aún perdura. Tu alegría y desparpajo me hicieron sentirme
10
relajada y cómoda cuando llegué al lab, así que por eso y por los años posteriores,
gracias.
A Ángel, el que me mortifica llamándome “la niña que habla raro”, le agradezco ser un
amigo que me ha ayudado siempre que he tenido cualquier problema informático o a la
hora de dar las prácticas. Contigo he compartido además buenos momentos de
almuerzos en el comedor, tapas y clases de inglés, con lo que has aportado felicidad a
estos años. Gracias también Carmen, con tu alegría traías aire fresco al laboratorio, y se
agradece muchísimo. A la Dra. Ester, por tu forma de ser y tu humor, has sido una parte
importante de estos años y te has convertido en una buena amiga. Gracias por compartir
esas largas horas en el departamento conmigo, sobre todo cuando ya oscurecía y aún
seguíamos sacando resultados, a la vez que nos sacábamos fotos con la bata y la luna
llena (y tengo pruebas). A los Drs. Jesús y Moha, por enseñarme que hay que trabajar
duro, pasar mucho tiempo sentado delante del ordenador, e invertir mucho tiempo en el
departamento para llegar lejos. A Eva, por ser un torbellino lleno de energía y hacer que
los días que pasábamos juntas en el lab fueran más divertidos. A María Lucena, por
compartir conmigo momentos de pipeteos con una agradable conversación. En general,
a todos los profesores/becarios/alumnos internos del departamento les agradezco lo bien
que me lo han hecho pasar y lo agradables que siempre han sido conmigo, dispuestos
siempre a entretenerme con una alegre conversación. Me llevo un buen recuerdo de este
departamento.
Mis años de Tesis no sólo se desarrollaron en esta universidad, sino que tuve la
oportunidad de pasar unos meses aprendiendo y compartiendo pipeteos en el laboratorio
del Dr. Josef Vanden Broeck en Leuven (Bélgica). A él le agradezco que me abriera las
puertas desde el principio, que tuviera siempre hueco para reunirse conmigo, se
interesara por cómo iba mi trabajo, y me organizara hasta una fiesta de despedida. Mis
agradecimientos son igual de grandes para Liesbeth Badisco, que a pesar de estar
embarazada se metía conmigo en el laboratorio y me introdujo de una manera muy
sencilla en el mundo de la qRT-PCR. Siempre tenía una sonrisa en su cara, y a pesar de
estar liada con mil cosas, siempre tenía un tiempo para mí. Lo mismo Joost, el técnico
de ese grupo, pasamos muchas horas juntas en el laboratorio y nos hicimos buenos
amigos. Siempre alegrándome los días con bromas y buena música, así que le doy las
gracias. Y en general gracias a todos los de aquel departamento, que a pesar de ser un
país muy frío, siempre me tenían arropada.
Durante parte de los 5 años en que he desarrollado la presente Tesis Doctoral, mi vida
se ha desarrollado tanto dentro como fuera del laboratorio. Agradezco a todos los
amigos y compañeros de piso que me han acompañado estos años y me han brindado su
apoyo y amistad, haciendo que “no todo fuera trabajo en esta vida”. No puedo concebir
mi etapa de Tesis sin ellos. En especial a mi equipo de Ultimate Frisbee “PenultimanosGranayd”, el cual tuve el honor de capitanear durante un año y ser siempre “la corazón
del equipo”. Gracias a todos los jugadores de todos los rincones del mundo que han
pasado por nuestro equipo y a toda la comunidad de jugadores españoles, por hacerme
11
desconectar del laboratorio y llegar cada lunes con una sonrisa, agujetas, o incluso un
pie roto, pero con ganas de trabajar. Gracias, gracias, gracias, ¡son muy grandes!
Para el final he dejado los agradecimientos a las personas más importantes en mi vida.
En primer lugar, agradezco infinitamente a mis padres Tomás y Mercedes la vida que
me han dado, y la educación que he recibido. Sin ellos, nunca hubiese llegado a donde
estoy ahora mismo, así que una gran parte de esta tesis es de ellos y para ellos. Gracias
por apoyarme, escucharme, y ayudarme a llegar a donde estoy ahora mismo. Estas
páginas se quedarían cortas para decir todo lo que me gustaría. Lo mismo a mi hermana
Marta, gracias por ser parte de mí, interesarte por mi trabajo, estar siempre a mi lado,
escucharme y darme ánimos cuando lo necesitaba. La distancia nos ha separado
físicamente pero no de corazón, así que espero que siempre sigamos estando la una para
la otra. Gracias. A los tres les agradezco enormemente el que hayan hecho un gran
esfuerzo para estar conmigo en un día muy especial. También agradezco a toda mi
familia canaria y torrecampeña todo el apoyo que me han dado estos años, siempre
interesándose por esta bendita Tesis, preguntando “cuándo voy a acabar” y diciéndome
cosas como “ojalá encontraras trabajo y te quedaras colocada”. También a mi familia
americana Kristine, Richard, Aurora y Christopher, porque en los más de dos años que
nos conocemos se han interesado por cada detalle de esta Tesis de una manera sin igual,
preguntando en cada llamada o visita cómo me iba en el laboratorio, y dándome ánimos
desde la distancia.
Y por supuesto MIL GRACIAS a Karl, mi pareja, amigo y compañero. Has llegado a
mi vida en la mitad de la tesis y me has llenado de alegría y felicidad. Gracias a tu
faceta de biólogo y a tu inigualable personalidad, me has transmitido fuerzas, paz y
tranquilidad para trabajar con muchas más ganas. Te agradezco que CADA DÍA al
llegar a casa te interesaras por los experimentos realizados ese día, que si había subido
la temperatura de esto, que si había mirado la plata de lo otro… He podido compartir
contigo esta etapa apasionante de desarrollar una Tesis Doctoral, y agradezco mil veces
a la vida que te hayas cruzado en mi camino (bendito Ultimate Frisbee). Gracias por ser
como eres y por estar siempre dispuesto a escucharme y darme ánimos. Gran parte de
esta Tesis es tuya también.
12
Índice
Resumen
17
Capítulo 1. Introducción general y Objetivos
25
El ADN ribosómico________________________________________27
Estructura, abundancia y función biológica_____________________ 27
Expresión del ADNr. El nucleolo______________________________29
El nucleolo como sensor de estrés y daño del ADN________________31
Estudio del nucleolo________________________________________32
Los ITSs (Espaciadores Internos Transcritos) ribosómicos_________ 33
Modelos de evolución del ADNr______________________________ 34
Los cromosomas B________________________________________ 37
Historia del descubrimiento__________________________________37
Características generales y frecuencia_________________________ 37
Tamaño y composición molecular_____________________________ 38
Origen___________________________________________________41
Comportamiento meiótico___________________________________ 42
Modelos de mantenimiento de los cromosomas B en las
poblaciones_______________________________________________44
Efectos__________________________________________________ 45
Eyprepocnemis plorans_____________________________________46
La especie________________________________________________46
El genoma________________________________________________47
Los cromosomas B de E. plorans______________________________48
Referencias_______________________________________________50
Objetivos________________________________________________65
Capítulo 2. B-Chromosome ribosomal DNA is functional in
67
the grasshopper Eyprepocnemis plorans
Abstract_________________________________________________ 69
Introduction______________________________________________ 69
Results__________________________________________________ 70
Cytological analysis______________________________________70
Molecular analysis_______________________________________70
Discussion_______________________________________________ 71
Material and methods_______________________________________73
Experimental material____________________________________ 73
13
Cytological analysis of B-NOR expression____________________73
Molecular analysis of B-NOR expression_____________________73
Supporting Information__________________________________74, 76
References_______________________________________________74
Capítulo 3. B1 was the ancestor B chromosome variant in the
western mediterranean area in the grasshopper
Eyprepocnemis plorans
77
Abstract_________________________________________________ 79
Materials and methods______________________________________80
Results and discussion______________________________________ 80
References_______________________________________________ 83
Capítulo 4. Ribosomal DNA is active in different B
chromosome variants of the grasshopper Eyprepocnemis
plorans
85
Abstract_________________________________________________ 87
Introduction______________________________________________ 87
Materials and methods______________________________________88
Biological samples and characterization of B variants___________88
Cytological analysis of rRNA gene expression in B chromosomes__89
Molecular analysis of rRNA gene expression in B chromosomes___89
Results__________________________________________________ 89
Discussion_______________________________________________ 92
References_______________________________________________ 94
Capítulo 5. B chromosomes in Eyprepocnemis plorans are
present in all body parts analyzed and show extensive
variation for rDNA copy number
97
Abstract________________________________________________ 100
Introduction_____________________________________________ 100
Materials and methods_____________________________________101
Biological material preparation____________________________101
B presence in the body parts______________________________ 102
B-rDNA copy number estimation at the individual and body
part levels_____________________________________________102
Fluorescent in situ hibridization (FISH)_____________________ 103
14
Statistical analyses______________________________________103
Results_________________________________________________ 103
Analysis of B chromosome presence________________________ 103
B-rDNA copy number estimation in male bodies_______________104
No qITS2_B copy number variation among body parts__________107
Discussion______________________________________________ 107
References______________________________________________ 109
Capítulo 6. Ribosomal DNA on a B chromosome shows
differential expression level in several body parts of the
grasshopper Eyprepocnemis plorans
113
Abstract________________________________________________ 116
Introduction_____________________________________________ 116
Materials and methods_____________________________________118
Biological samples______________________________________118
Total RNA extractions and complementary DNA (cDNA)
synthesis______________________________________________118
B-rDNA expression in different body parts___________________118
Target and housekeeping genes primers___________________ 118
Housekeeping reference genes validation and relative
quantification of B-rDNA expression______________________119
Statistical analysis____________________________________ 120
Results and discussion_____________________________________ 120
References______________________________________________ 123
Supporting information____________________________________ 127
Capítulo 7. HP1 knockdown is associated with abnormal
condensation of almost all chromatin types
129
Abstract________________________________________________ 132
Introduction_____________________________________________ 132
Material and methods______________________________________135
Biological samples______________________________________135
Molecular analyses______________________________________135
Nucleic acid isolation and genotyping_____________________135
HP1 gene amplification, dsRNA synthesis and delivery_______ 136
HP1 silencing analysis_________________________________136
Analysis of rDNA, Bub1 and Hsp70 genes expression patterns
after HP1 knockdown__________________________________137
Cytological techniques___________________________________137
15
Silver Stain__________________________________________138
C-Banding__________________________________________ 138
Fluorescent in situ hybridization (FISH)___________________138
Immunofluorescence analysis___________________________ 138
Statistical Analyses_____________________________________ 139
Results _________________________________________________139
HP1 knockdown was effective in RNAi males_______________ 139
Influence of HP1 knockdown on the activity of other genes____ 141
Physiological effects of HP1 knockdown___________________141
Cytological effects of HP1 knockdown_____________________142
Discussion______________________________________________ 145
References______________________________________________ 149
Supporting information____________________________________ 154
Capítulo 8. High variation of ITS2 rDNA region and nonrandom expression of rDNA units in a grasshopper
genome
157
Abstract________________________________________________ 160
Introduction_____________________________________________ 160
Materials and methods_____________________________________163
Biological samples and karyotypic characterization____________163
gDNA and RNA extractions, cDNA synthesis and B-NOR
activity analysis________________________________________ 163
Tagged PCR and amplicon NGS sequencing__________________163
Data analysis__________________________________________ 164
Whole-Genome Shotgun Sequencing-NGS____________________165
Secondary structure and genetic diversity analyses_____________165
Statistical analyses______________________________________165
Results_________________________________________________ 165
Preliminary analysis of ITS2 variation______________________ 165
Body part experiment____________________________________166
Population experiment___________________________________167
Differential expression among haplotypes____________________170
Discussion______________________________________________ 172
References______________________________________________ 177
Supporting information____________________________________ 182
Capítulo 9. Discusión general
185
Referencias______________________________________________197
16
Capítulo 10. Conclusiones
203
Capítulo 11. Perspectivas
207
Resumen
17
18
Resumen
Resumen
El ADN ribosómico (ADNr) es un componente esencial de los genomas porque codifica
para el ARN ribosómico que es el componente principal de los ribosomas junto con una
serie de proteínas ribosomales, y son los responsables de la síntesis proteica. Se localiza
en clusters altamente repetidos en tándem y esto posibilita la síntesis masiva de
ribosomas en períodos de rápido crecimiento. Cada cluster está separado por los
Intergenic Spacers (IGS) y formado por tres genes ribosómicos para los ARN 18S, 5.8S
y 28S (en animales), separados entre sí por los Internal Transcribed Spacers 1 y 2
(ITS1 e ITS2, respectivamente), que se transcriben pero no son incorporados al
ribosoma maduro. Delante del gen para el ARN 18S se encuentra el External
Transcribed Spacer (EGS). De todas las repeticiones de ADNr que hay en un genoma,
sólo el 50% están transcripcionalmente activas en un momento dado.
Eyprepocnemis plorans es una especie de saltamontes cuyo genoma estándar
está organizado en 23 cromosomas (11 parejas autosómicas y el cromosoma sexual con
determinismo X0/XX). Además de estos cromosomas (A), puede albergar un número
variable de cromosomas supernumerarios (también denominados cromosomas B). Los
cromosomas B son dispensables, de naturaleza heterocromática, que no recombinan con
los cromosomas A, muestran mecanismos de transmisión no mendeliana y están
constituidos principalmente por una variedad de secuencias repetidas entre las que
destacan ADN satélite (ADNsat), ADNr y elementos móviles. Sin embargo, estudios
recientes han revelado que los cromosomas B de esta especie, en la población española
de Torrox, son capaces de organizar nucleolos que pueden visualizarse asociados a las
Regiones Organizadoras Nucleolares (NORs) de los Bs. La obtención de ADN de varios
cromosomas, mediante microdisección, y su amplificación por PCR, permitió comparar
las secuencias de las regiones ITS y detectar la existencia de una inserción de una
adenina en la región ITS2 que sólo se observó en las secuencias procedentes del
cromosoma B. Este fue el punto de partida de la presente tesis doctoral, con la que
hemos pretendido ampliar estos resultados preliminares analizando la estructura y
expresión de la región ITS2 a los niveles de partes corporales, individuo y población.
En primer lugar, realizamos un estudio combinado, citogenético y molecular, de
la expresión del ADNr de los cromosomas B 24 de machos y hembras de E.plorans
procedentes de Torrox. El análisis citogenético se hizo mediante tinción argéntica de
células en profase meiótica I, y el molecular mediante el diseño de primers para PCR
que anclaran en la adenina diferencial del ITS2 del cromosoma B, cuyo amplicón
llamamos ITS2_B. Estos primers nos permitieron detectar molecularmente transcritos
procedentes del ADNr del B, tanto en machos como en hembras. Así, de los 29 machos
portadores de cromosomas B analizados, alrededor del 50% mostraron un nucleolo
asociado a la NOR de alguno de sus cromosomas B, confirmando resultados anteriores
en esta población. Además, cuando el macho tenía un B activo, formaba nucleolo en el
20% de las células, en promedio, aunque la variación entre individuos era alta (5 -50%).
19
La correspondencia entre la tinción argéntica y la amplificación del ITS2_B fue positiva
en todos los machos en los que visualizamos nucleolos en el B, a excepción de tres
casos. En estos tres machos, observamos nucleolo pero no transcritos o viceversa,
sugiriendo que la proporción de células con B-NOR activa es demasiado baja como para
detectar transcritos (en el primer caso) o que los nucleolos se desorganizan
tempranamente y por ello no se detectan transcritos (en el segundo). Al mismo tiempo,
no se detectaron transcritos ITS2_B en machos que no portaban cromosomas B. En las
hembras, la actividad de la NOR del B no puede ser estudiada citogenéticamente,
debido a la dificultad de analizar la meiosis femenina, pero sí pudimos detectar
transcritos ITS2_B en 10 de las 13 hembras portadoras de cromosomas B, así como su
ausencia en hembras sin B. Estos resultados ya han sido publicados (Ruiz-Estévez M,
López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome Ribosomal DNA is
functional in the grasshopper Eyprepocnemis plorans. PLoS ONE 7(5): e36600.
doi:10.1371/journal.pone.0036600).
En E.plorans se han descrito más de 50 variantes de cromosomas B, sólo en la
Península Ibérica. Estas variantes se diferencian en la composición relativa de las dos
secuencias repetitivas de ADN que principalmente componen los Bs (ADNr y ADNsat)
y en su tamaño relativo con respecto al cromosoma X. Para caracterizar mejor esta
variación, hemos realizado un estudio exhaustivo de la distribución de estas dos
secuencias en los cromosomas B encontrados en 17 poblaciones naturales de E.plorans
plorans localizadas en la región mediterránea occidental, incluyendo la Península
Ibérica, las Islas Baleares, Sicilia y Túnez. Los resultados pusieron de manifiesto que en
estas 17 poblaciones hay cuatro tipos de variantes: B 1, B2, B5 y B24. El B1 es el más
ampliamente distribuido por lo que se puede considerar que es el tipo ancestral para la
región analizada. Se caracteriza por cantidades similares de ambos tipos de ADN en las
poblaciones de la Península Ibérica, Sicilia y Túnez, y por tener una cantidad un poco
mayor de rDNA en las Islas Baleares. Sin embargo, los otros tres tipos, B 2, B24 y B5 ,
contienen más ADNsat que ADNr en proporciones 2:1, 3:1 y 2:1, respectivamente. El
tamaño del B24 es la mitad del X, y el del B5 llega ser dos tercios. Para el B1 y el B2 ,
encontramos variabilidad para el tamaño entre poblaciones. Así, el tamaño del B 1 es
aproximadamente la mitad del X en las Islas Baleares, mientras que en poblaciones de
las provincias de Alicante, Murcia y Albacete (todas ellas de la Península Ibérica) su
tamaño es dos tercios del X. Igualmente, el B2 es aproximadamente un tercio del tamaño
del X en poblaciones de Granada, mientras que en Málaga su tamaño es la mitad.
Además, encontramos evidencia de que los cromosomas B de esta especie siguen
abriéndose nuevos caminos evolutivos, al encontrar una nueva variante (B 2i) en Maro
(Málaga) que presumiblemente surgió a través de una inversión paracéntrica que
cambió las posiciones relativas del ADNr y parte del ADNsat. (Manuscrito aceptado en
Cytogenetic and Genome Research).
Tras conocer las diferencias estructurales de las diferentes variantes de Bs,
decidimos ampliar el estudio de la expresión del ADNr del B a otras variantes, tales
como B1 , B2 y B5 , además de volver a estudiar el B24 tres años después del anterior
estudio. Bajo la hipótesis de que los cromosomas B son de reciente aparición en
20
Resumen
E.plorans, deberíamos esperar que todas las variantes tuvieran la capacidad de expresar
su ADNr pues no habría habido tiempo de que ocurrieran mutaciones que los
silenciaran. Para someter a prueba esta hipótesis, analizamos la expresión del B, a los
niveles citogenético y molecular, en machos procedentes de 11 poblaciones españolas:
cuatro procedentes de la provincia de Málaga (Algarrobo, Nerja, Torrox y Fuengirola),
dos de la provincia de Granada (Salobreña y Otívar), una de la de Murcia (Cieza), una
de Alicante (San Juan), una de Albacete (Mundo), y dos de la isla de Mallorca
(S’Albufereta y S’Esgleieta). Los resultados mostraron no sólo expresión del ADNr
localizado en el cromosoma B24 de Torrox, sino también en el B1 de Mundo, San Juan y
S’Esgleieta, y en el B2 de Otívar, Salobreña y Algarrobo, pero en estas dos variantes la
proporción de células con B-NOR activa era mucho menor que la anteriormente
reportada para B24. Por el contrario, no detectamos expresión de la variante B 5. Además,
detectamos que en machos con menos de un 10% de células con nucleolo en el B no es
posible detectar transcritos ITS2_B, y que la probabilidad de detectar molecularmente la
actividad de la NOR del B parece ser independiente del tamaño del nucleolo de dicho
cromosoma. Estos resultados ya han sido publicados (Ruiz-Estévez M, López-León
MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is active in different B
chromosome variants of the grasshopper Eyprepocnemis plorans. Genetica 141(79):337-345, doi: 10.1007/s10709-013-9733-6).
La puesta a punto del procedimiento molecular para detectar la presencia de
transcritos ITS2_B nos permitió abordar el estudio de la estabilidad mitótica de los
cromosomas B de E. plorans. Para ello, nos planteamos analizar si el cromosoma B está
presente en las diferentes partes del cuerpo de los individuos con cromosomas B. Hasta
ahora se sabía que los cromosomas B de esta especie son mitóticamente estables en
espermatocitos y células somáticas de los ciegos gástricos, mostrando el mismo número
en ambos casos. Pero no se conocía qué pasaba en el resto del cuerpo, debido a la
imposibilidad de observar cromosomas condensados en células en interfase. En nuestro
estudio, hemos detectado molecularmente la presencia del cromosoma B (es decir, de la
secuencia ITS2_B, específica del B) en 8 partes del cuerpo diferentes con tejido
somático en ambos sexos (cabeza, ganglio cerebral, antena, músculo alar, pata saltadora,
ciegos gástricos, túbulos de Malphigi y glándula accesoria en machos) y también en
ovariolas en hembras y testículos en machos, tras amplificar el marcador ITS2_B y
también un marcador SCAR puesto a punto previamente, para reforzar el diagnóstico.
Además, analizamos el número de copias de ITS2_B que tienen los cromosomas B 24 y
B2 en machos con diferente número de Bs, para intentar utilizarlo como método que nos
permitiera determinar el número de Bs que tiene un individuo, a partir de su ADN, y así
ver si además ese número se mantenía estable entre diferentes partes del cuerpo. No
obstante, observamos una gran variabilidad para el número de copias de ADNr por
cromosoma B (B-ADNr), incluso entre individuos de la misma población y con el
mismo número de Bs, por lo que no es posible averiguar el número de Bs que tiene un
individuo a través del número de copias de B-ADNr. El análisis mediante FISH de
varios machos con números de copias muy divergentes corroboró la coexistencia en la
población de bandas de ADNr muy diferentes en tamaño en los cromosomas B de
21
diferentes individuos, sugiriendo la existencia de posibles eventos de amplificación
diferencial en el B-ADNr mediante sobrecruzamiento desigual durante la meiosis. Sin
embargo, cuando cuantificamos el número de copias de ADNr del B 24 en diferentes
partes corporales de machos y hembras, no observamos variabilidad significativa.
(Manuscrito en preparación).
Una vez demostrado que el B está presente en todas las partes del cuerpo, que el
ADNr del B está ocasionalmente activo, y que esta expresión puede detectarse en
testículo mediante análisis citológico o molecular y en otras partes del cuerpo (sin
necesidad de que haya células en división celular) mediante análisis molecular,
quisimos averiguar si dicha expresión muestra variación entre esas partes. Para ello,
analizamos molecularmente la expresión del ITS2_B en 6 partes del cuerpo diferente
(cabeza, músculo alar, testículo, ciegos gástricos, pata saltadora y glándula accesoria) de
machos con B24 donde previamente habíamos observado citológicamente la formación
de nucleolos por parte del B en las gónadas. Los resultados indicaron que el ADNr del
B se expresaba en todas las partes analizados, con niveles de expresión (analizados
mediante qPCR) que variaban entre ellas. La parte del cuerpo con mayor expresión del
B-ADNr era el testículo, seguido por el músculo alar, la glándula accesoria, la pata
saltadora, los ciegos gástricos y la cabeza, en este orden. Esto podría sugerir la
existencia de diferencias entre las partes del cuerpo con respecto al requerimiento de
ARNr, por las demandas metabólicas que tenían en el momento de ser congelados para
su análisis, pudiéndose requerir que, en algunos casos, las células tuvieran que necesitar
incluso transcritos procedentes del B. (Manuscrito en preparación).
La heterocromatina que forma parte de los cromosomas B es constitutiva y ésta
también se localiza en las regiones pericentroméricas de todos los cromosomas A.
Además, hay heterocromatina facultativa en el bivalente S 9 y en el cromosoma X. La
Proteína Heterocromática 1 (HP1) es necesaria para el silenciamiento de genes
heterocromáticos, la regulación de la transcripción de genes eucromáticos, la
organización de la cromatina y la conservación de la integridad cromosómica. Por tanto,
realizamos un estudio en el que a través de ARN de interferencia (ARNi) disminuimos
los niveles de expresión de HP1 en E.plorans, y así analizamos el efecto que dicha
disminución tuvo sobre la heterocromatina, la expresión de otros genes y la estructura
de los cromosomas en dicha especie. Los resultados revelaron que los genes
ribosómicos (ARNr) y el de la proteína de choque térmico 70KD (Hsp70) no cambiaron
sus niveles de expresión tras la disminución de HP1, pero sí lo hizo el gen de la
quianasa serina/treonina de punto de control mitótico (Bub1). Este hecho vino
acompañado de varios efectos fenotípicos tales como la condensación anormal de todos
los tipos de cromatina (y no sólo la heterocromatina, que era el efecto esperado), la
existencia de células con puentes cromosómicos, una alta frecuencia de
macroespermátidas, la presencia de menor cantidad de hemolinfa, menor número de
células en división y, finalmente, una reducción drástica de la supervivencia.
(Manuscrito en preparación).
Por último, y para intentar caracterizar en profundidad la variación para el ITS2
en una población de E. plorans, así como el grado en que se expresan las diferentes
22
Resumen
variantes encontradas, realizamos varios experimentos mediante 454 “amplicon
sequencing” (Next Generation Sequencing, NGS) de la región ITS2 del ADNr de
E.plorans procedentes de la población de Torrox, donde el B predominante es B 24.
Además de algunos experimentos preliminares que nos ayudaros a perfeccionar el
diseño experimental, realizamos dos experimentos principales: 1) Amplificación por
PCR de la región ITS2 mediante cebadores anclados en los genes 5.8S y 28S del ARNr,
en ADN genómico (ADNg) y ADN complementario (ADNc) obtenido a partir del ARN
total extraído ambos a partir de diferentes partes del cuerpo de un macho sin B; y 2) El
mismo protocolo fue aplicado a 18 machos (estudio poblacional), con diferentes
números de cromosomas B (0-3). Para optimizar el diseño y abaratar costes, utilizamos
etiquetas de 6 nucleótidos asociadas a la región 5’ de los cebadores que nos permitieron
mezclar, por un lado, las 12 muestras de las diferentes partes del cuerpo, y por otro, las
36 muestras de los 18 machos, y separarlas tras haberlas secuenciado en conjunto (cada
experimento en 1/8 de placa). El análisis de los resultados fue realizado mediante una
serie de scripts escritos en Python (por nosotros). Una de las tareas más complicadas fue
diferenciar la enorme variedad de secuencias resultantes (en cada muestra) de los
errores inherentes a la secuenciación 454, donde cerca del 1% de las secuencias suelen
llevar algún error. Para ello, utilizamos un control interno proporcionado por la parte de
las lecturas que incluía 123 nucleótidos de región codificadora (parte del gen 5.8S y
parte del gen 28S). Para ello, estimamos la proporción de lecturas que llevaban esos 123
nt idénticos a los que se han reportado para otros saltamontes acrídidos (incluyendo E.
plorans y L. migratoria) y asumimos que esas lecturas no estaban sujetas a error. Eso
nos permitió deducir la tasa de error a partir del resto de las lecturas de la misma
muestra. La tasa de error así estimada en el experimento poblacional de E. plorans fue
de 2,28%, por lo que decidimos considerar como válidas todas aquellos tipos de lecturas
cuya frecuencia superase este valor. La selección de tipos de ITS2 en cada muestra, una
vez aplicado el control interno, demostró la existencia de 3 haplotipos (Hap1-Hap3) en
las diferentes partes del cuerpo y 6 haplotipos (Hap1-Hap6) en el estudio de población
(que incluían los 3 anteriores), un valor que contrastó con lo observado en uno de los
experimentos preliminares realizado en L. migratoria, donde había sólo un haplotipo.
Estos 6 haplotipos de E. plorans demuestran que la homogenización del ITS2 en E.
plorans es poco eficiente, en contraste con la de las secuencias codificadoras que era
muy elevada, con el 97,72% de las secuencias siendo idénticas. En los experimentos
preliminares en E. plorans también aparecieron cinco de los seis haplotipos, lo que
aboga también por la credibilidad de este resultado.
Uno de los haplotipos (Hap4) era portador de la inserción de la adenina
mencionada anteriormente, y sólo estaba presente en el ADNg de los individuos con
cromosomas B. No apareció en ninguno de los individuos sin B. Además había
asociación significativa entre el número de lecturas para el Hap4 y el número de Bs.
Todo esto indica que este haplotipo es específico del cromosoma B, y su presencia es la
que habíamos estado detectando con los primers ITS2_B. Los haplotipos más
divergentes se diferencian por hasta cuatro mutaciones, y su estructura secundaria es
muy similar en todos ellos, indicando la energía libre de Gibbs que todos tienen la
23
capacidad de expresarse. Y, de hecho, todos estaban presentes en el cDNA, aunque con
diferentes valores de expresividad, destacando, sobre todo, la bajísima expresión del
haplotipo específico del B que nos lleva a concluir que el B está muy silenciado. De
hecho, sólo aparecieron lecturas del Hap4 en el cDNA de 5 de los 12 individuos con B
y, en esos 5 individuos este haplotipo se encontraba en muy baja frecuencia.
Finalmente, las diferencias de expresión de los diferentes haplotipos ITS2 entre
diferentes partes del cuerpo e individuos se repiten, en general apareciendo el Hap1
sobreexpresado y el Hap3 subexpresado, aunque este patrón muestra pequeñas
variaciones entre las partes del cuerpo. En los 18 machos, el patrón con los cuatro
haplotipos restantes se repite entre ellos: Hap3, Hap4 y Hap6 están subexpresados y el
Hap5 está sobreexpresado. Estas diferencias de expresión entre haplotipos, que a la vez
son propias de cada uno de ellos, sugieren que las copias de ARNr no se expresan al
azar. (Manuscrito en preparación).
24
Capítulo 1. Introducción general y Objetivos
25
26
Introducción general y Objetivos
1. El ADN ribosómico
1.1. Estructura, abundancia y función biológica
El ADN ribosómico (ADNr) es una secuencia de ADN repetida en tándem que alberga
los genes para el ARN ribosómico (ARNr) que formará parte de la estructura de los
ribosomas. En animales, cada repetición (cistrón) 45S está formada por los tres genes
ribosómicos 18S, 5,8S y 28S. En la mayoría de eucariotas, estos genes están en lugares
genómicos diferentes de los genes que codifican el ARNr 5S. Los genes del cistrón
ribosómico 45S están separados entre sí por dos espaciadores internos que se
transcriben (ITS1 e ITS2) y flanqueados por dos espaciadores externos transcritos
(ETS) y los espaciadores intergénicos no transcritos (IGS) (Long y David, 1980)
(Figura 1).
Figura 1. Estructura y composición del ADNr. (Extraída de Eickbush y Eickbush, 2007).
El número de repeticiones en el ADNr puede variar desde una copia por genoma
haploide que posee Tetrahymena, hasta cientos de copias, y está correlacionado
positivamente con el tamaño del genoma (Prokopowich y col., 2000). Numerosos
organismos poseen muchas más copias de ADNr de las que necesita para suplir su
requerimiento de producción de ARNr, permaneciendo
muchas de ellas
transcripcionalmente inactivas, incluso a altas tasas de crecimiento (Reeder, 1999).
Debido a su alto número de repeticiones, el ADNr produce tal cantidad de transcritos
que el ARNr es el producto génico más abundante en la célula. En Saccharomyces
cerevisiae por ejemplo, aproximadamente 150 copias de ADNr están localizadas en el
cromosoma XII, ocupando aproximadamente el 60% del cromosoma y el 10% de su
genoma (Kobayashi y col., 2011) mientras que los genomas de animales y plantas
pueden contener cientos o miles de copias (Rogers y Bendich, 1987). Los loci de ADNr
pueden también variar, en cuanto al número de repeticiones y localización
cromosómica, dentro del mismo género o incluso dentro de la misma especie. Un
ejemplo de esta variación ha sido descrito por Sánchez-Gea y col. (2000) encontrando
dentro del género Zabrus una gran variabilidad para el número de loci de ADNr, el
número de cromosomas que portaban ADNr y el tamaño de esos loci. En Drosophila
melanogaster, donde las NORs se localizan en los cromosomas sexuales, el fenotipo
27
bobbed (bb) está asociado con un bajo número de copias de ADNr en los
individuos con dicho fenotipo, y cuando el número de copias es inferior al 15% de las
presentes en el fenotipo salvaje, se produce letalidad en embriones en desarrollo (Long
y David, 1980; Lyckegaard y Clark 1991). Este efecto deletéreo se ha descrito también
en vertebrados (Delany y col. 1994), lo que sugiere la necesidad de un número mínimo
de copias de genes ribosómicos para el correcto desarrollo y supervivencia de los
organismos.
Varios mecanismos han sido propuestos para explicar la variación en el número
de copias de los genes ribosómicos, aunque las fuerzas evolutivas responsables de ellos
no han sido encontradas aún (Bik y col., 2013). Estos mecanismos podrían ser la
compensación, la magnificación, la contracción y el entrecruzamiento desigual entre
cromátidas hermanas o entre cromosomas. La compensación ocurre porque no todas las
copias de ADNr están activas a la vez, y por ello la tasa de transcripción de una célula
no tiene por qué ser necesariamente proporcional al número de copias de genes de
ARNr. Un claro ejemplo lo encontramos en Drosophila que aunque posee 200-250
copias de ARNr, sólo son necesarias 35-60 de ellas para mantener una viabilidad normal
en el laboratorio (Ritossa, 1968). La magnificación y la contracción del número de
copias se ha detectado en Daphnia obtusa (McTaggart y col., 2007) y Drosophila
melanogaster (Averbeck y col., 2005), lo que pone en evidencia que el ADNr está
evolucionando dinámicamente. En Xenopus, la magnificación solo ocurre durante la
oogénesis (Rogers y Bendich, 1987), que es cuando hay alto requerimiento energético.
La amplificación de copias ARNr puede ocurrir también en localizaciones
extracromosómicas como en los protozoos (Kafatos y col., 1985), e incluso se ha
sugerido que las múltiples copias de los genomas de cloroplastos y mitocondrias sean
para incrementar la dosis de ARNr de la célula más que para codificar proteínas (Rogers
y Bendich, 1987). Por último, un entrecruzamiento desigual entre genes ARNr de
cromátidas hermanas o diferentes cromosomas produce copias de más en uno de los
implicados, y de menos en el otro, conduciendo a variabilidad intraindividual para el
número de copias de ARNr. Este mecanismo ha sido bien estudiado por Lyckegaard y
Clark (1991) en los cromosomas sexuales de Drosophila melanogaster.
.
Los genes ribosómicos 45S y 5S dan lugar a las moléculas de ARNr que
conforman el núcleo de las subunidades ribosómicas (Sollner-Webb y Tower, 1986)
junto con las proteínas ribosómicas. Los ribosomas son orgánulos celulares
imprescindibles compuestos por dos subunidades: la subunidad mayor, que contiene los
genes 5S, 5,8S y 28S, y la subunidad menor que contiene el gen 18S; ambas
subunidades, además, tienen un alto número de proteínas ribosómicas. En ellos ocurre la
síntesis de proteínas en todos los organismos. La biogénesis de ribosomas conlleva una
gran inversión de energía celular, y está estrechamente regulada en cada célula en
respuesta a varios estímulos ambientales que afectan a la síntesis proteica, el
crecimiento celular y la proliferación.
28
Introducción general y Objetivos
1.2. Expresión del ADNr. El nucleolo
Las repeticiones de ADNr se localizan en las constricciones secundarias de los
cromosomas, las cuales se pueden visualizar al microscopio y reciben el nombre de
Regiones Organizadoras Nucleolares (NORs) (Heitz, 1931; McClintock, 1934; Raska y
col., 2006a, 2006b). A pesar de que el alto número de repeticiones de ADNr de los
eucariotas ha sido interpretado como un efecto de la alta demanda de proteínas en
ciertas situaciones, lo cierto es que aproximadamente el 50% esas copias permanecen
transcripcionalmente inactivas en levaduras y humanos (French y col., 2003).
Los genes ribosómicos 45S son transcritos por la ARN polimerasa I (ARN pol I)
como un único precursor del rRNA que es metilado en varias regiones y del que se
escinden los ETS e ITSs dando lugar a los tres ARN ribosómicos, 18S, 5.8S y 28S. El
cuarto ARNr, 5S, es transcrito por la RNA pol III (Highett y col., 1993). El estado de
fosforilación de muchos componentes de la maquinaria de la ARN pol I puede
modificar la actividad y las interacciones de esas proteínas y así modular la
transcripción del ADNr durante el ciclo celular (Sirri y col. 2008). La activación de los
genes de ADNr depende sobre todo del estado en el que se encuentre la célula, el cual es
dependiente a su vez de los requerimientos energéticos que precise el tejido y el
individuo al que pertenece. Cuando se activa la transcripción de los genes ribosómicos
45S se organiza el nucleolo en las NORs (Figura 2).
El nucleolo es una estructura altamente organizada donde los ribosomas están
siendo madurados y ensamblados, lo que implica que se estén importando desde el
citoplasma al núcleo muchas proteínas ribosómicas y factores accesorios de
procesamiento, y exportando al citoplasma las subunidades que conformarán el
ribosoma. Durante el ciclo celular en los eucariotas superiores, la producción de
ribosomas empieza al final de la mitosis, incrementa durante G1, es máxima en G2 y
finaliza durante profase (Gébrane-Younès y col., 1997; Sirri y Hernández-Verdun,
2000). Además de estar implicado en la formación de ribosomas, el nucleolo es un
dominio plurifuncional involucrado en la respuesta al estrés, la biogénesis de partículas
de ribonucleoproteínas independientes a las subunidades ribosómicas y en
enfermedades como el cáncer, las ribosomopatías o las infecciones virales (Olson y col.,
2000; Boisvert y col., 2007; Hiscox, 2007; Pederson y Tsai, 2009). Asimismo, su papel
clave en el mantenimiento de la homeostasis celular y la integridad genómica ha sido
propuesto recientemente (Grummt, 2013).
Cuando el nucleolo de las células animales es visualizado al microscopio
electrónico, se observa una estructura tripartita: una región pequeña y brillante llamada
centros fibrilares, rodeada por un material densamente teñido llamado el componente
denso fibrilar, y el resto del nucleolo contiene lo que aparentemente son gránulos
densamente empaquetados (el componente granular) (Shaw y Jordan, 1995). Muchos
apuntan a que la estructura refleja la compartimentación de la maquinaria relacionada
con la transcripción del ADNr, el procesamiento del ARNr y el ensamblaje de las dos
subunidades ribosómicas (Hernández-Verdun y col., 2010), respectivamente.
Recientemente, Thiry y col., (2011) han mostrado que la organización del nucleolo es
29
cuerpos fibrilares, al igual que ocurre con los nucleolos de Drosophila e insectos
(Knibiehler y col., 1982, 1984). Aun así, las controversias sobre la organización
nucleolar no serán totalmente resueltas hasta que entendamos la función y la
composición molecular de estas tres estructuras descritas.
Al final de la profase, cuando la membrana nuclear ha desaparecido totalmente y
los cromosomas están condensados, el nucleolo ya no es visible pero los bloques que
conformarán el futuro nucleolo están almacenados y mantenidos en diferentes
localizaciones celulares durante la división. Cuando la división celular llega al final y
comienza la telofase, el nucleolo vuelve a ensamblarse en un complejo proceso que se
extiende durante un tiempo relativamente largo del ciclo celular. El ensamblaje depende
de la coordinación entre la activación de la transcripción de ADNr y el reclutamiento y
activación de complejos de procesamiento del ARN (Hernández-Verdun y col., 2002).
Además, la translocación de estos complejos a los sitios de transcripción de ADNr está
unida a la formación de unas estructuras llamadas cuerpos prenucleolares (Stevens,
1965; Ochs y col., 1985).
Figura 2. Célula meiótica en diplotene mostrando un bivalente
cromosómico asociado a dos nucleolos (nu), uno por
cada cromosoma homólogo,debido a la activación del
ADNr, revelado por la técnica de impregnación argéntica.
La regulación de la expresión del ADNr y la organización de nucleolos es muy
compleja, como lo refleja el fenómeno de dominancia nucleolar según la cual no todas
las NORs se encuentran activas en la célula (Pikaard, 2000a; Pikaard, 2000b; Reeder,
1985). Éste fenómeno se observa en híbridos interespecíficos donde frecuentemente las
NORs de un progenitor forman nucleolo mientras que las del otro parental permanecen
30
Introducción general y Objetivos
inactivas, a pesar de que las secuencias de ARNr de los dos parentales son
esencialmente idénticas. La dominancia nucleolar resulta entonces de la transcripción de
un solo set parental de genes de ARNr, y se relaciona con la necesidad que tiene el
genoma de controlar la dosis activa de ARNr (Preuss y Pikaard, 2007). Este fenómeno
de expresión génica diferencial puede ser inestable, parcial o reversible (Volkov y col.,
2007) y se observa ampliamente en la naturaleza, tanto en plantas, como insectos,
anfibios y mamíferos. Este mecanismo epigenético está regulado via ARN de
interferencia (ARNi) (Preuss y col., 2008; Tucker y col., 2010), metilación de citosinas
en el ADN, modificación de histonas y factores de remodelación de la cromatina
(Preuss y Pikaard 2007; Volkov y col., 2007), mientras que la impronta gamética no
parece ser el mecanismo por el cual uno se inactiva el ARNr de uno de los partentales.
La base molecular por la cual se elige qué genes son inactivados, permanece todavía sin
clarificar.
En general, se considera que las repeticiones de ARNr que están inactiva s
aparecen en forma de heterocromatina constitutiva, altamente condensadas, mientras
que las repeticiones activas aparecen en forma de eucromatina, dando lugar a zonas
accesibles para la maquinaria de transcripción. Sin embargo, otros autores proponen que
estos dos estados principales en los que existe la cromatina ribosómica podrían derivar
en tres: un estado inactivo similar a la heterochromatina, un estado transcripcionalmente
competente pero inactivo, y un estado transcripcionalmente productivo (Huang y col.,
2006). Las modificaciones post-traducionales, es decir, las modificaciones en el ADN y
en las histonas asociadas, son las que permiten distinguir los dos estados principales de
la cromatina ribosómica. Los promotores de los genes activos están hipometilados y las
histonas asociadas altamente acetiladas, ocurriendo lo contrario para los promotores de
genes inactivos (Santoro y col., 2002; Nemeth y col., 2008). Además, las copias
silenciadas de los promotores de ADNr tienen metilada la histona H3K9 y están
asociadas con la Proteína Heterocromática 1 (HP1), molécula asociada principalmente
(pero no exclusivamente) a la heterocromatina (James y Elgin, 1986). En levaduras
ambos tipos de cromatina están entremezclados, argumentando en contra de que la
activación/inhibición de la transcripción está controlada por dominios cromosómicos y
a favor de la independencia de regulación que tiene cada repetición de ADNr
(Dammann y col., 1995; French y col., 2003).
1.3. El nucleolo como sensor de estrés y daño del ADN
Hay varias líneas de investigación que sugieren que el nucleolo tiene un papel en la
detección y la respuesta al estrés causado por una variedad de factores, como falta de
nutrientes, presencia de algún elemento extra en el genoma (por ejemplo, cromosomas
B parasíticos), contaminación ambiental o virus (Langerstedt, 1949; Hudson y
Ciborowski, 1996; Camacho y col., 2000; Hiscox, 2007; Boulon y col., 2010, Grummt
2013). En general, los nucleolos son más pequeños en condiciones de estrés (Olson,
2004) ya que la célula disminuye la transcripción del ADNr, la síntesis de proteínas y
ribosomas, y además protege el genoma al inducir mecanismos de reparación de ADN o
31
apoptosis. Esta hipótesis parte de la base de la gran asociación que hay entre el tamaño
del genoma y el número de copias de ADNr, y defiende que las copias extras presentes
en el ADNr (que no se transcriben) amortiguarían dicho daño, para así asegurar que las
copias no dañadas estuvieran disponibles para la síntesis de ribosomas (Kobayashi,
2008). De forma similar, se ha argumentado que las copias extra pueden facilitar la
reparación del ADNr por recombinación homóloga (Ide y col. 2010).
En levaduras, el cambio morfológico que sufre el nucleolo en respuesta al estrés
va acompañado además de liberación de ARN pol I desde el nucleolo y deacetilación de
la histona H4. Por lo tanto, parece que la respuesta al estrés también hay un mecanismo
de modulación de la estructura nucleolar mediado por la cromatina (Tsang y col., 2003).
En mamíferos hay muchas evidencias de la relación existente entre el daño del ADN
mediado por p53 y el nucleolo, sugiriendo que la estructura nucleolar es un sensor del
daño de ADN (Rubbi y Milner, 2003). Si se deteriora la función nucleolar, se estabiliza
p53 mediante la prevención de su degradación y de esta manera, las células pueden
responder a la actividad nucleolar aberrante mediante la inducción de la detención del
ciclo celular y/o la apoptosis (Mayer y Grummt, 2005). También, el tamaño del
nucleolo es generalmente más grande en células cancerosas, hecho que ha sido
relacionado con la alta proliferación celular que ocurre en este tipo de células. Además,
muchos supresores de tumores y proto-oncogenes afectan a la producción de ribosomas
(Ruggero y Pandolfi, 2003).
1.4. Estudio del nucleolo
Analizar las NORs activas y, por tanto, el número de nucleolos que tiene una célula da
información del requerimiento energético que tiene la célula, y ese número puede variar
entre individuos e incluso entre células del mismo individuo. Además, la evaluación de
la distribución de las NORs activas da información de la tasa de proliferación de
tumores en algunos tipos de lesiones (Derenzini, 2000). El tamaño del nucleolo está
positivamente correlacionado con la tasa de síntesis de ARNr y por tanto de ribosomas
(Mosgoeller, 2004), la cual conlleva el reclutamiento de proteínas necesarias para la
transcripción del ADNr (Derenzini, 2000). No hay relación numérica entre las NORs
que aparecen en metafase y las de interfase: una NOR metafásica puede ser distribuída
en muchas NORs interfásicas, al igual que muchas NORs metafásicas pasan a ser una
durante la interfase (Derenzini y Ploton, 1994).
En el nucleolo se localizan un grupo de proteínas ácidas que son altamente
argirófilas, lo que hace que pueda observarse citogenéticamente con la técnica de
Impregnación Argéntica (Goodpasture y Bloom, 1975; Rufas y col., 1982). Esta técnica
es muy útil, ya que de una manera simple permite medir el tamaño nucleolar e así
indirectamente medir la transcripción de los genes ARNr, ya que lo que tiñe
específicamente es la maquinaria transcripcional de la ARN polimerasa I, incluyendo la
B23, nuclelina, las proteínas UBF y las subunidades de la ARN polimerasa I (Roussel y
col., 1992; Roussel y Hernandez-Verdun, 1994; Roussel y col., 1996). Por tanto, lo que
hace décadas empezó siendo un análisis de la presencia/ausencia de nucleolos o de la
32
Introducción general y Objetivos
variación del tamaño de éste, se ha podido completar a lo largo de los años con el
significado biológico de esas observaciones, en términos de actividad transcripcional
del ADNr.
A lo largo del tiempo se han propuesto dos métodos para analizar los resultados
de la impregnación argéntica: el método de conteo (Crocker y col., 1989) y el método
morfométrico (Derenzini y col., 1989b; Rüschoff y col., 1990). El primer método
consiste en la enumeración de cada nucleolo teñido en cada célula, y si están muy
agregados algunos nucleolos y no se pueden diferenciar, se cuentan como uno. Esto
hace que este método sea subjetivo y poco reproducible. Sin embargo, el segundo
método mide el área ocupada por todas las estructuras teñidas por plata (todos los
nucleolos) y se analiza con un sistema de imágenes (Trerè y col., 1995). Este
procedimiento es más rápido, más preciso, más objetivo y más reproducible que el
método de conteo (para un ejemplo de empleo del método, ver Teruel y col. 2007,
2009).
1.5. Los ITSs (Espaciadores Internos Transcritos) ribosómicos
El ADNr es generalmente procesado post-transcripcionalmente para dar lugar a tres
moléculas maduras de ARNr, 18S, 5.8S y 28S, que resultan de eliminar del transcrito
precursor los ETS, ITS1 e ITS2. Aunque los ITSs no forman parte del ribosoma, se
encargan de señalizar el correcto procesamiento de los transcritos de ARNr. En
eucariotas microbianos, el tamaño del ITS1 varía desde 100 a 400pb, mientras que el
ITS2 desde 200-500pb. Algunos ITSs son inusualmente largos, como los del alga roja
Cyanidioschyzo merolae (Maruyama y col., 2004), donde el tamaño medio de los ITS1
e ITS2 son 862 y 1738pb, respectivamente. Euglena gracilis tiene uno de los ITS1 más
largos, 1188pb (Schnare y col., 1990), y el del dinoflagelado Cochlodinium
polykrikoides contiene una secuencia de 101pb repetida en tándem, dando lugar a un
ITS1 de 813pb (Ki y Han, 2007). Yarrowia y Giardia tiene los ITSs más pequeños
conocidos de los eucariotas microbianas, siendo la suma de los dos ITS en Y. lipolytica
tan solo 150pb (van Heerikhuizen y col., 1985), mientras que los de G. intestinalis
miden tan solo 89pb (Boothroyd y col., 1987). Algunas especies de Microsporidia
directamente no tienen ITS2 (Vossbrinck y Woese, 1986).
Los ITSs son partes no codificantes del ADNr, por lo que sobre ellos la
selección natural no actúa pudiendo, por tanto, acumular mutaciones. Debido a esto, los
ITSs evolucionan rápidamente y su secuencia es más heterogénea en comparación con
la región codificante del ADNr (Matyášek y col., 2012, entre otros), hecho que les hace
ser uno de los marcadores más usados para la identificación de especies (Horton y
Bruns, 2001; Bridge y col. 2005) y en estudios filogenéticos (Alvarez y Wendel, 2003;
Coleman, 2003; Pettengill y Neel, 2008). Esta característica por un lado, y la estructura
secundaria tan conservada por otro, hacen concretamente del ITS2 una herramienta
excepcional para estudios de metagenómica (Seifert, 2009; Blaalid y col., 2012; Schoch
y col., 2012; entre otros). Además, la inclusión de la estructura secundaria en la
reconstrucción filogenética hacen que ésta sea más robusta y cercana a la realidad
33
(Keller y col., 2010). Sin embargo, recientemente el uso de los ITSs para identificar
especies se ha puesto en duda, ya que se han publicado varios estudios en los que se
detecta variabilidad intraespecífica (Kảrén y col., 1997; Kauserud y Schumacher, 2002;
Nilsson y col., 2008; Blaalid y col., 2013) e intragenómica para dichas secuencias en
una amplia variedad de taxones, incluyendo procariotas, plantas, animales y hongos
(Mayol y Rosselló 2001; Feliner y col. 2004; Wörheide y col. 2004; Stage y Eickbush
2007; Stewart y Cavanaugh 2007; Simon y Weiss 2008; James y col. 2009; Pilotti y col.
2009; Alper y col. 2011; Hřibová y col. 2011; Vydryakova y col. 2012; Li y col. 2013).
Algunos autores (Alper y col. 2011; Song y col. 2012) advierten de que el uso de los
ITSs como identificador de especies debe ser evaluado en cada caso, porque la
variabilidad que existe para su secuencia puede sobreestimar la riqueza real de especies
que existe en una comunidad (Lidner y col. 2013).
1.6. Modelos de evolución del ADNr
Para explicar la evolución de familias multigénicas, entre las que se encuentra el ADNr,
se han propuesto varias teorías, destacando la evolución concertada (Zimmer, 1980) y la
evolución mediante nacimiento y muerte (Nei y Hughes, 1992) (Figura 3). En general,
se considera que las familias multigénicas evolucionan siguiendo un patrón de
evolución concertada, por el que se homogenizan las secuencias de ADN de los genes
miembros de la misma familia. Brown y col. (1972) fueron los primeros que
propusieron que las copias de los genes de ARNr evolucionan “horizontalmente”, con
nuevas variantes surgiendo por mutación y dispersándose reemplazando a otras copias.
El principal mecanismo de homogenización es la recombinación desigual entre copias
repetidas (Smith 1973; Szostak y Wu 1980; Kobayashi y col. 1998; Eickbush y
Eickbush, 2007), que genera nuevos genes duplicados con secuencia idéntica y elimina
otros genes duplicados. Se asume que los genes de una familia multigénica son
polimórficos, pero que estos polimorfismos evoluciona a la vez (Nei y col., 1997)
debido a la evolución concertada. Si este proceso continúa, los genes duplicados de una
familia multigénica tienden a tener secuencias de nucleótidos similares, incluso aunque
estén ocurriendo mutaciones. Además de la recombinación, también se ha propuesto
que la conversión génica, es decir, la transferencia unidireccional de una secuencia de
ADN desde una cadena donante a una receptora (Gangloff y col., 1996), es un
mecanismo que homogeniza secuencias. La evolución de de la familia génica de ADNr
es un buen ejemplo de evolución concertada ya que las diferentes unidades suelen tener
secuencias de ADN muy similares en individuos de la misma especie (Ganley y
Kobayashi, 2007; Stage y Eickbush, 2007). Cuando el modelo de evolución concertada
fue propuesto, se creía que incluso los ITSs tenían secuencias de ADN conservadas,
pero hoy en día se sabe que no es así (véase apartado 1.5.).
Aunque se ha pensado durante mucho tiempo que la evolución de las familias
multigénicas se producía siempre por evolución concertada, Nei y Hughes observaron
en 1992 que otras familias, como la del Complejo Mayor de Histocompatibilidad
(MHC) y los genes de Inmunoglobulinas (Ig) de la misma especie no estaban
34
Introducción general y Objetivos
necesariamente más relacionados entre ellos que entre especies diferentes (Gojobori y
Nei, 1984; Hughes y Nei, 1989; Nei y Hughes, 1991; Nei y Hughes, 1992; Ota y Nei,
1994), por lo que propusieron el modelo de evolución por nacimiento y muerte. En este
modelo, los genes duplicados pueden aparecer por varios mecanismos, como son la
duplicación en tándem y por bloques, y tras una fuerte selección purificadora, unos
genes divergen y se hacen funcionales y otros se convierten en pseudogenes debido a
mutaciones deléteras o son eliminados del genoma. El resultado es una familia
multigénica con una mezcla de grupos de genes, unos divergentes y otros altamente
homólogos, acompañados de un sustancial número de pseudogenes. Por tanto, la
presencia de pseudogenes en una familia de genes, los cuales pueden ser tolerados de
manera diferente según el genoma hospedador (Eickbush y col., 1997), sugiere que está
evolucionando por el modelo de nacimiento y muerte. Se ha sugerido que este modelo
podría explicar también los inusuales altos niveles de polimorfismos de los ITSs e IGSs
de algunas especies (superior al 40% en algunos casos). Otro ejemplo de este tipo de
evolución lo encontramos en los genes 5S de los hongos filamentosos (Rooney y Ward,
2005).
Para explicar la diferente asociación de las familias multigénicas con cada uno
de estos dos modelos evolutivos, Nei y col. (1997) propusieron que el ADNr
evolucionaba por evolución concertada debido a que tiene que producir una gran
cantidad del mismo producto, por lo que los genes de esta familia deberían ser
altamente homólogos, mientras que las multifamilias MHC e Ig lo hacen por nacimiento
y muerte ya que tienen la función de defender al hospedador de diferentes tipos de
parásitos, haciendo necesaria una gran cantidad de diversidad. Aunque la evolución
concertada y la evolución por nacimiento y muerte son conceptualmente diferentes,
pueden ser difícilmente distinguibles si se asume que la tasa con la que se produce la
evolución concertada es muy baja (Nei y col., 2000).
Figura 3. Modelos de evolución de las familias multigénicas
(extraído de Nei y col., 1997): Evolución concertada (izquierda)
y modelo de nacimiento y muerte (derecha)
35
La evolución del ADNr no tiene que ceñirse estrictamente a estos dos modelos,
sino que pueden existir matices. Así, Ganley y Kobayashi (2007) propusieron un
modelo “de evolución concertada de “rápida homogenización” (Figura 4) para explicar
por qué existía tan poca variación para las secuencias de ADNr a pesar de tener regiones
altamente variables como los IGSs. Este modelo proponía tres fases para homogenizar
un array de secuencias repetidas: 1) Ocurre una mutación en una secuencia de ADNr y,
como éste es altamente redundante, las fuerzas de selección no actúan sobre la
mutación, con lo que puede persistir durante un tiempo; 2) Hay un paso de transición en
el que continuos entrecruzamientos desiguales entre las secuencias repetidas producen
duplicaciones que llevan la mutación, algunas se dispersarán por el genoma tras
sucesivas duplicaciones, y otras serán eliminadas (estocásticamente). Sólo las
mutaciones no deletéreas y toleradas por la selección natural podrán aumentar su
frecuencia hasta un umbral. Quedarán muchos polimorfismos de baja frecuencia que no
han podido superar el umbral porque comprometen la eficacia biológica del portador o
porque son de reciente aparición; 3) La fijación hace que las repeticiones mutadas
toleradas se mantengan en la población, reemplazando a las antiguas repeticiones. Este
modelo es consistente con resultados presentados en estudios previos (Liao y col., 1997;
Ganley y Scott 1998, 2002; Skalicka y col., 2003; Averbeck y Eickbush, 2005; Kovarik
y col., 2005). En resumen, los autores sugieren que debido a que los individuos tienden
a tener arrays homogéneos, los polimorfismos entre individuos de una población son
casos donde la homogenización ha dispersado una mutación a todas las repeticiones del
array en un individuo, creándose así un polimorfismo fijado.
Figura 4. Modelo de “rápida
homogenización” de evolución
concertada (extraído de Ganley
y Kobayashi, 2007).
36
Introducción general y Objetivos
2. Los cromosomas B
2.1. Historia del descubrimiento
Los genomas eucarióticos, además de contener los genes que colaboran con el buen
funcionamiento del organismo en los cromosomas estándar (también llamados A),
pueden albergar también elementos genéticos egoístas que interaccionan con él
procurando maximizar su propia expansión y transmisión, aún a costa de disminuir la
eficacia biológica de los individuos portadores (ver revisión de Burt y Trivers, 2006).
Entre éstos podemos destacar, por ejemplo, los transposones, los
distorsionadores de la segregación, algunos factores citoplasmáticos y los cromosomas
B. Estos últimos fueron los primeros en ser descubiertos hace un siglo por Wilson
(1907) al observar un cromosoma “extra” en el hemíptero Metapodius (ahora llamado
Acanthocepal), y al ver que no se comportaba como los cromosomas A, lo llamó
cromosoma “supernumerario”. Tras este descubrimiento, seguidamente fueron descritos
otros casos en el escarabajo Diabrotica (Stevens, 1908) y en el maíz (Kuwada, 1915). A
lo largo de la historia, muchos han sido los nombres que se le han dado a los
cromosomas B, tales como “fragmentos extras de cromosomas” (Müntzing, 1944;
Östergen, 1945), “cromosomas superfluos” (Hakansson, 1945) y “cromosomas
accesorios” (Hakansson, 1948; Müntzing, 1948) entre otros. Pero fue Randolph en 1928
el primero en acuñar el término de “cromosomas B”, y es el que ha perdurado hasta la
actualidad.
2.2. Características generales y frecuencia
Los cromosomas B se han encontrado formando parte del genoma de más de 2000
especies de plantas, animales y hongos y se estima que el 15% de genomas eucarióticos
llevan Bs (véase las revisiones de Jones y Rees 1982, Jones 1995, y Camacho 2005).
Las especies donde se han descrito cromosomas Bs pertenecen predominantemente a
ciertos grupos taxonómicos, como las Gramíneas, las Liliáceas y los Ortópteros, pero
esto es debido a que son grupos donde se llevan a cabo un elevado número de estudios
citogenéticos. En base a las características de los cromosomas B, son varias las
definiciones que se han dado de estos cromosomas supernumerarios. Así, en 1982 Jones
y Rees los definieron como “cromosomas no homólogos a los cromosomas del
complemento normal (cromosomas A), que no recombinan con ellos y además son
totalmente dispensables”. En 1993, JPM Camacho y JS Parker los definieron durante la
primera “B Chromosome Conference” como “cromosomas dispensables, presentes en
algunos individuos de algunas poblaciones de especies de plantes y animales, que ha
surgido probablemente de los cromosomas A, pero que siguen su propio camino
evolutivo al no recombinar con ellos” (Beuckeboom, 1994a). Además, no hay que
olvidar otra característica muy importante inherente al hecho de que los cromosomas B
no recombinan: no siguen las leyes Mendelianas de segregación, ya que poseen una
segregación meiótica irregular que les hace acumularse en la línea germinal. De ahí le
37
viene el adjetivo de “egoísta”, ya que se transmiten con tasas superiores a las de los
cromosomas As.
La frecuencia con la que los cromosomas B aparecen en las poblaciones
naturales es muy variable ya que depende del grado de tolerancia del genoma
hospedador y de la fuerza del mecanismo de acumulación de los Bs. Los factores
geográficos, históricos y ecológicos tales como la existencia de barreras geográficas que
impiden la migración de individuos portadores de cromosomas B a ciertas poblaciones,
el tiempo trascurrido desde que aparece el B en una población o la permisibilidad de las
condiciones ambientales son otros factores que explican la variación temporal y espacial
que muestra, pudiéndose encontrar poblaciones de la misma especie con y sin
cromosomas B. Los Bs son deletéreos cuando aparecen en un número alto en los
genomas hospedadores, así que por lo general el número de Bs que tiene un individuo
no suele ser mayor de 3 ó 4. Sin embargo, hay estudios donde se han encontrado
excepciones. Así, el mayor número de cromosomas B encontrado en una planta es de
50, en la especie Pachyphytum fittkaui (Crassulaceae). Otros casos de plantas con
muchos cromosomas Bse han descrito en el maíz con 34 Bs (Jones y Rees, 1982), 31 en
Gibasis karwinskyana (Kenton, 1991), 26 en Fritillaria japonica (Noda, 1975) y 22 en
Centaurea scabiosa (Fröst, 1957). En animales también se ha encontrado individuos
con alto número de Bs, como en Apodemus peninsulae donde se han observado hasta 24
Bs (Volobujev y Timina, 1980), 20 en Xylota nemorum (Boyes y Van Brink, 1947) y 16
en Gonista bicolor (Sannomiya, 1974) y en Leiopelma hochstetteri (Green, 1988).
2.3. Tamaño y composición molecular
El tamaño de los cromosomas B es muy variable entre especies. En algunas especies,
como en Reithrodontomys megalotis, los Bs son más pequeños incluso que los As más
pequeños (Peppers y col., 1997). En Megaselia scalaris, el cromosoma B no es más que
un centrómero independiente, siendo el elemento más pequeño que puede ser
considerado un cromosoma (Wolf y col., 1991). En el otro extremo, están los
cromosomas B de Uromys caudimaculatus (Baverstock y col., 1982) y Astyanax
scabripinnins (Mestriner y col., 2000) que son tan grandes como sus cromosomas As
más grandes. También hay casos donde los Bs tienen un tamaño mayor que los As de su
propia especie, como en Alburnus alburnus (Ziegler y col., 2003), aunque parecen ser
isocromosomas. La mayoría de Bs tienen un tamaño medio, aunque incluso dentro de la
misma especie pueden mostrar variación en el tamaño, tal y como se ha observado en
diferentes poblaciones españolas (Henriques-Gil y col., 1984; López-León y col., 1993)
i marroquíes (Bakkali y col. 1999) de Eyprepocnemis plorans. El tamaño del
cromosoma B es una característica que afecta a su estabilidad mitótica (Hewitt, 1979).
Así, los cromosomas B grandes tienden a ser mitóticamente estables, es decir, todas las
células del individuo tienen el mismo número de cromosomas B. Sin embargo, los Bs
pequeños suelen ser mitóticamente inestables.
Tradicionalmente se ha descrito a los cromosomas B como elementos
heterocromáticos, ya que muestran un alto grado de compactación de la cromatina con
38
Introducción general y Objetivos
lo que es posible distinguirlos citogenéticamente de los cromosomas A. Debido a su
naturaleza heterocromática los cromosomas B han sido tradicionalmente considerados
genéticamente inactivos, es decir, que no producían transcritos procedentes de las
secuencias génicas que contenían, frecuentemente ADN ribosómico (ADNr). En este
sentido apuntaron varios estudios, como los realizados en el saltamontes Myrmeleotettix
maculatus (Fox y col., 1974), el ratón Apodemus peninsulae (Ishak y col., 1991), la rata
negra Rattus rattus (Stitou y col. 2000) y los peces Metynnis maculatus (Baroni y col.,
2009) y Haplochromis obliquidens (Poletto y col., 2010). Sin embargo, con el paso de
los años son varios los estudios que han aportado evidencias citogenéticas de la
actividad del ADNr de los cromosomas B como ocurre en los saltamontes Dichroplus
pratensis (Bidau 1986) y Eyprepocnemis plorans (Teruel y col., 2007, 2009) (Figura 5)
o en el ratón Apodemus peninsulae (Boeskorov y col., 1995). Otras evidencias
moleculares indirectas se han encontrado en la rana Leiopelma hochstetteri (Green
1988) y el mosquito Simulium juxtacrenobium (Brockhouse y col., 1989), y directas en
la planta Crepis capillaris (Leach y col. 2005), la avispa Trichogramma kaykai (van
Vugt y col., 2005), el centeno (Carchilan y col., 2007, 2009; Banaei-Moghaddam y col.,
2013), y el ciervo siberiano Capreolus pygargus (Trifonov y col., 2013).
Figura 5. Activación del ADNr del cromosoma
de Eyprepocnemis plorans, tal y como indica la
presencia de nucleolo (marrón) (extraída de
Teruel y col., 2009).
La compactación tan elevada que tienen los cromosomas B se debe a su
composición molecular, ya que están formados mayoritariamente por secuencias de
ADN mediana y altamente repetidas que varían en el tipo de repeticiones y en el
tamaño de éstas (Amos y Dover, 1981; Eickbush y col., 1992). Estas secuencias son
39
ADNs satélites (ADNsat), ADNr y elementos transponibles (transposones), que se
acumulan debido al entrecruzamiento desigual y a la falta de recombinación
(Charlesworth y col., 1986; Stephan 1987). Estudios recientes han revelado que
algunos Bs llevan además genes de histonas (Teruel y col., 2010), secuencias derivadas
de genes de los As (Martis y col., 2012; Banaei-Moghaddam y col., 2013) o secuencias
que codifican para proteínas (Trifonov y col., 2013).
El ADNsat de los Bs puede ser compartido por los As de su misma especie,
como en Crepis capillaris (Jamilena y col., 1994), en Drosophila subsilvestris
(Gutknecht y col., 1995); o por el contrario ser específico del B, como el ADNsat del
cromosoma PSR (Paternal Sex Ratio) de Nasonia vitripennis (Nur y col., 1988). Puertas
en su revisión de 2002 reúne más ejemplos de ADNsat compartido por los Bs y As (en
Zea mays o Secale cereale) y otros de secuencias de ADNsat específicas de los
cromosomas B. En muchos casos, los Bs tienen mayor cantidad de secuencias repetidas
comparado con el genoma del que se originó, sugiriendo que ocurren fenómenos de
amplificación de ADNsat en los Bs en una corta escala de tiempo. Algunos estudios han
sugerido que este hecho podría hacer que un neo-B se estabilizara y llegara a ser
seleccionado positivamente dentro del núcleo (Reed y col., 1994; Leach y col., 1995).
Los cromosomas B pueden acumular transposones provenientes de diversas
fuentes (Beukeboom, 1994a; Camacho y col., 2000) ya que son heterocromáticos y no
recombinan con los otros elementos del genoma. Los transposones que se han descrito
en cromosomas B (veáse Tabla 4.2 de Camacho, 2005) son muy diversos. Algunos
ejemplos son el retrotransposón NATE (NAsonia Transponible Element) que invade el
cromosoma PSR de Nasonia vitripennis (McAllister, 1995; McAllister y Werren, 1997),
el retrotransposón CfT-I responsable de la transposición de ADN cloroplastídico en el
cromosoma B de Brachycome dichromosomatica (Franks y col., 1996) o los
retrotransposones Gypsy, RTE y R2 y el transposon mariner presentes en la especie
Eypepocnemis ploras (Montiel y col. 2012, Montiel y col., in preparation). En los
últimos años, se han descubierto además secuencias específicas de los Bs que proceden
de elementos transponibles (Langdon y col., 2000; Lamb y col., 2007). De esta manera
los transposones son responsables de generar variabilidad en los cromosomas B.
Además, esta transposición de secuencias hacia los Bs puede ocasionar que los genes de
estos cromosomas se vean inactivados, ya sea porque se insertan en medio de un gen, o
porque rompen la estructura del cromosoma (Camacho y col., 2000).
Otra de las secuencias repetidas que forman mayoritariamente parte de los Bs es
el ADNr 45S (Green, 1990). Sin embargo, el gen de ADNr 5S (que suele aparecer en
los genomas separado del cistrón 45S) sólo se ha detectado en algunos cromosomas B,
como son los de la especie Plantago lagopus (Dhar y col., 2002) y el cromosoma B de
Eyprepocnemis plorans de las poblaciones del Cáucaso (Cabrero y col., 2003). La
variación que existe para el número de repeticiones de los cistrones de ADNr 45S
influye significativamente en el tamaño de los cromosomas B (Adam, 1992; Pukkila y
Skrzynia, 1993). Se ha sugerido que las constricciones secundarias (NORs), donde se
localiza el ADNr, son regiones propensas a producir roturas cromosómicas que podrían
ser el origen de un neo-B. Como se dijo en este mismo apartado, se han citado casos de
40
Introducción general y Objetivos
Bs con NORs activas, y es por esto que Teruel y col. (2009) proponen que la cromatina
del ADNr puede encontrarse en tres estados: silenciada, competente o activa.
Además de las secuencias de nucleótidos que componen los cromosomas B, su
organización y función depende también de la existencia de estructuras secundarias y
modificaciones epigenéticas en dichos cromosomas. Así, la naturaleza heterocromática
de los B se atribuye en parte a la presencia de estructuras secundarias en su ADN, como
ocurrre en el cromosoma PSR, donde pequeñas secuencias palindrómicas están
asociadas con intercambios entre repeticiones de dicho cromosoma, sugiriendo que
provocan recombinación entre repeticiones (Reed y col., 1994). También se ha
observado formación de horquillas in vivo en un cromosoma B microdiseccionado de
Leiopelma hochstetteri (Sharbel y col., 1998). Entre las modificaciones epigenéticas, la
metilación y la acetilación son dos de los cambios más frecuentemente descritos. El
primero tiene un papel fundamental en la inactivación de cromosomas sexuales
(Holliday, 1987) y por tanto, también en la inactivación del B, ya que ambos sistemas
tienen muchas similitudes (Camacho y col., 2000). Un ejemplo de este proceso lo
encontramos en repeticiones centroméricas hipermetiladas del B de Brachycome
dichromosomatica, las cuales causan su inactivación (Leach y col., 1995) o en la
inactivación de la NOR del B de Eyprepocnemis plorans (López-León y col. 1991,
1995). El segundo proceso ha sido reportado para Brachycome dichromosomatica, por
Houben y col. (1997b), cuyo cromosoma B está hipoacetilado y podría estar también
ayudando a mantener su inactividad.
2.4. Origen
El origen de los cromosomas B es uno de los aspectos más estudiados de estos
cromosomas. La creencia más extendida es que los Bs proceden de los As de la misma
especie, como un subproducto de la evolución del cariotipo estándar (Jones y Rees,
1982; Camacho y col., 2000). Ya en los años 1970s y 80s se vieron los primeros
indicios de que el ADN encontrado en los Bs de algunas especies era muy similar al
encontrado en los As (véase la revisión de Jones y Rees, 1982). En los años 1990s se
siguió estudiando el origen de los Bs con más profundidad, llevándose a cabo el
aislamiento, clonación y secuenciación de secuencias de ADN repetidas de los Bs.
Algunas resultaron ser específicas de ellos y otras compartidas con los As (véase la
revisión de Beukeboom 1994a; Hackstein y col., 1996). La realidad es que los
cromosomas B pueden surgir a partir de los As de su misma especie (origen
intraespecífico) o tras hibridar con una especie emparentada (origen interespecífico).
Los Bs con origen intraespecífico surgen a partir de cromosomas A, como una copia
extra (polisomía) que se heterocromatiniza rápidamente, adquiriendo así la misma
apariencia y comportamiento meiótico que los Bs (Hewitt, 1973a; Peters, 1981;
Talavera y col., 1990). También, los neo-Bs pueden surgir a partir de fragmentos
céntricos originados tras translocaciones robertsonianas o a partir de la amplificación de
la región paracentromérica de un cromosoma A fragmentado (Keyl y Hägele, 1971).
Así, Dhar y col. (2002) encontraron que la aparición del B de Plantago lagopus podría
41
estar asociada a la amplificación del 5S tras la fragmentación de un cromosoma A.
Otros ejemplos de Bs con origen intraespecífico los encontramos en Crepis capillaris
(Jamilena y col., 1994, 1995) y en el centeno (Houben, 1996; Puertas, 2002), donde los
investigadores encontraron secuencias compartidas por los As y los Bs. Por otro lado,
los cromosomas B también pueden proceder de los cromosomas sexuales, ya que la
polisomía de estos es más tolerada (Hewitt, 1973a). En Leiopelma hochstetteri Green y
col. (1993) y Sharbel y col. (1998) observaron que su cromosoma B parece proceder del
cromosoma sexual heteromórfico W, debido a su parecido en morfología y secuencia.
La teoría de que los cromosomas B se pueden originar además
interespecíficamente tras procesos de hibridación entre especies emparentadas fue
propuesta por primera vez por Battaglia (1964). La evidencia supone la existencia de
secuencias específicas del B de una especie, en los As de una especie emparentada. Esta
teoría ha sido validada en varias ocasiones: McAllister y Werren (1997) reportaron el
caso del cromosoma PSR de Nasonia vitripennis, el cual tiene un transposón cuya
secuencia es más parecida a los copias presentes en especies emparentadas del género
Trichomalopsis que a las presentes en su propio genoma y Sapre y Deshpande (1987)
demostraron la formación espontánea de un cromosoma B tras hibridar dos especies
emparentadas, Coix aquanticus y Coix gigantea. Otras demostraciones empíricas de
esta teoría, es la formación de novo del cromosoma B de Poecilia formosa, que se
origina tras hibridar P. mexicana y P. latipinna (Schartl y col., 1995), y la del neo-B
originado tras introducir una región cromosómica de Nasonia giraulti en N. vitripennis
(Perfectti y Werren, 2001).
2.5. Comportamiento meiótico
Los cromosomas A aparecen formando bivalentes, lo que posibilita que los cromosomas
homólogos recombinen entre ellos para posteriormente migrar cada uno de ellos a un
polo celular durante la primera división meiótica. Este es el principio de la segregación
mendeliana. Sin embargo, los cromosomas B pueden no formar bivalentes y, como
univalentes, pueden sacar ventaja a la hora de transmitirse a los futuros gametos. En
muchos casos, los cromosomas B migran preferentemente al polo que dará lugar al
oocito, consiguiendo así tasas de transmisión mayores del 50%. El comportamiento
meótico de los Bs varía entre individuos y entre especies. Rebollo y col. (1998) vieron
que en la primera metafase meótica los Bs se comportan a veces tan estáticos como los
X, otras veces un poco menos dinámicos, y otras se comportan como un univalente muy
dinámico. Estos autores también vieron otra característica importante del B durante esta
fase como es la reorientación de polo a polo que realiza este univalente, tal y como
ocurre con el cromosoma X de Melanoplus differentialis (Nicklas, 1961). Así, cualquier
polo es susceptible de contener estos univalentes, ya que están migrando de polo a polo
durante la anafase I meiótica de la espermatogénesis.
La acumulación del B puede ser premeiótica, debido a no-disyunción durante las
mitosis embrionarias y el destino preferencial de los productos mitóticos con mayor
número de Bs hacia la línea germinal. Este tipo de acumulación implica que las células
42
Introducción general y Objetivos
que entran en meiosis tienen anormalmente un número alto de cromosomas B en
comparación con los que originariamente contenía el cigoto. Esto fue reportado por
primera vez por Nur (1963) en el saltamontes Calliptamus palaestinensis al observar
que espermatocitos del mismo individuo tenían número variable de Bs. Otros ejemplos
los encontramos en el B de Locusta migratoria, cuya inestabilidad mitótica hace que
las células con alto número de cromosomas B den lugar preferencialmente a las futuras
espermatogonias (Nur, 1969; Kayano, 1971; Viseras y col., 1990).
En muchos casos, la acumulación del B ocurre durante la meiosis femenina
como resultados de la asimetría funcional que existe en la producción de óvulos, ya que
se origina tan sólo uno a partir de cada oogonia. Los cromosomas A tienen la misma
probabilidad de migrar tanto al oocito secundario (futuro óvulo) como al corpúsculo
polar, pero esto no ocurre con los cromosomas Bs. Estos, en sus movimientos de polo a
polo pasan más tiempo en el oocito secundario, por lo que tendrán mayor oportunidad
de permanecer ahí al final de la anafase (Hewitt 1976). Ejemplos de acumulación
meiótica los encontramos en la planta Lillium callosum (Kayano, 1957) y en los
saltamontes Melanoplus femur-rubrum (Lucov y Nur, 1973; Nur, 1977), Myrmeleotettix
maculatus (Hewitt, 1973a, 1976), Heteracris litoralis (Cano y Santos, 1989),
Omocestus burri (Santos y col., 1993) y Eyprepocnemis plorans (Zurita y col., 1998;
Bakkali y col., 2002).
En plantas es frecuente la acumulación del B después de la meiosis, ya que la
formación del grano de polen implica dos divisiones mitóticas tras la meoisis que da
lugar a los núcleos vegetativos y generativos. La acumulación se produce cuando hay
no-disyunción del B en estas mitosis y las dos cromátidas del B migran preferentemente
al núcleo generativo. Este mecanismo se vio por primera vez en el centeno (Hasegawa,
1934), donde además ocurre acumulación del B en la primera mitosis de la megaespora
(Jones, 1995; Puertas, 2002). La acumulación postmeiótica puede ocurrir en la primera
mitosis del grano de polen, como en Festuca pratensis (Bosemark 1954) y Secale
cereale (Jones y Puertas 1993; Jiménez y col., 1997), o en la segunda mitosis tal y como
ocurre en el maíz (Roman, 1948).
Además de los tres tipos de acumulación explicados hasta ahora, existe la
acumulación ameiótica. Este caso se da, por ejemplo, en el cromosoma B (llamado
PSR) de la avispa Nasonia vitripennis, una especie haplodiploide. El PSR causa la
condensación del juego cromosómico paterno en los espermatozoides, haciendo que el
huevo fecundado no sea diploide (hembra), sino haploide (haploide), por lo que
distorsiona la proporción de sexos a favor de los machos. Así, la tasa de transmisión del
PSR es próxima a 1, y es considerado uno de los cromosomas B más parasíticos
(Werren, 1991).
43
2.6. Modelos de mantenimiento de los cromosomas B en las
poblaciones
Se han propuesto dos modelos para explicar el mantenimiento de los cromosomas B en
las poblaciones naturales. El modelo “parasítico” o egoísta sostiene que los Bs se
mantienen por sus mecanismos de acumulación, permaneciendo en las poblaciones a
pesar de los efectos deletéreos que suelen causar a los organismos hospedadores
(Östergen, 1945). El modelo “heterótico” propone que los Bs se mantienen debido a los
efectos beneficiosos que confieren a los portadores, en bajo número, y no debido a
mecanismos de acumulación (White, 1973). La mayoría de los sistemas de cromosomas
B que se han analizado en profundidad, hasta ahora, se ajustan mejor al modelo
parasítico (véase revisión en Camacho, 2005). Estos dos modelos llevan implícita la
existencia de un equilibrio entre dos fuerzas contrapuestas. En el parasítico, estas
fuerzas son la acumulación del B, que incrementa su frecuencia, y la selección
fenotípica contra los portadores, que la disminuye. En el heterótico, el equilibrio resulta
de la selección fenotípica a favor de los individuos con pocos B y la que se produce
contra los individuos con muchos B. Sin embargo, estos equilibrios pueden verse
alterados por la incorporación al juego coevolutivo de respuestas defensivas por parte
del genoma hospedador. Así se ha demostrado la existencia de variantes génicas en los
cromosomas A capaces de suprimir la acumulación de los cromosomas B en el
saltamontes Myrmeleotettix maculatus (Shaw y Hewitt, 1985), en el hemíptero
Pseudococcus affinis (Nur y Brett, 1985) y en plantas como el centeno y el maíz (para
revisión, ver Puertas 2002). Esto constituye una clara evidencia de que entre los
cromosomas A y B se produce una “carrera de armamentos” similar a la que se produce
en otros sistemas hospedador-parásito. Una consecuencia de esta carrera de armamentos
es la aparición de cromosomas B neutralizados, es decir, que han perdido su capacidad
de acumulación y se transmiten a la misma tasa que los cromosomas A. La primera
evidencia fue aportada por López-León y col. (1992) al demostrar que los tres tipos de
cromosomas B más ampliamente distribuidos en las poblaciones españolas del
saltamontes Eyprepocnemis plorans (B1, B2 y B5) muestran tasas de transmisión
similares a las de los cromosomas A, es decir, cada B es transmitido a la mitad de los
gametos, como predice la ley mendeliana de la segregación. Posteriormente, Herrera y
col. (1996) demostraron que los cromosomas B neutralizados tienen la capacidad de
acumularse, pero está reprimida en la población natural, presumiblemente por la
selección de variantes génicas en los cromosomas A que suprimen la acumulación del
B. Posteriormente, Zurita y col. (1998) encontraron una nueva variante (B24) en la
población malagueña de Torrox, derivada de un B neutralizado, que se acumulaba con
una tasa media de transmisión de 0,7, lo que indicó que un cromosoma B puede
recuperar la capacidad de acumulación y el comportamiento parasítico corroborando
además la existencia de cromosomas B parásitos y neutralizados en diferentes
poblaciones de E. plorans.
Para explicar este mosaico geográfico de relaciones coevolutivas entre los
cromosomas A y B, Camacho y col. (1997) propusieron un modelo, derivado del
44
Introducción general y Objetivos
parasítico, que no asume que el sistema tenga que conducir necesariamente a un
equilibrio, sino a una sucesión en el tiempo y en el espacio de diferentes relaciones
coevolutivas. Basándose en sus estudios sobre el sistema de cromosomas B del
saltamontes E. plorans, estos autores propusieron que, para invadir nuevas poblaciones,
los cromosomas B necesitan tener acumulación, por lo que comenzarían su andadura
con acumulación (drive). Conforme aumenta su frecuencia, los cromosomas B se
convierten en una carga cada vez mayor para la población, debido a los efectos
deletéreos que suelen causar a los individuos portadores, por lo que cualquier variante
alélica de los cromosomas A que sea capaz de suprimir la acumulación de los B será
favorecida por la selección natural. Finalmente, cuando estos alelos de resistencia (que
suprimen la acumulación del B) se establezcan en la población, los Bs se habrán
convertido en elementos neutros, que se transmiten a la misma tasa que los A. Pero el
juego coevolutivo no termina ahí, ya que los cromosomas B suelen tener elevadas tasas
de mutación (López-León y col., 1993; Bakkali y Camacho, 2004) y los B neutralizados
pueden mutar a nuevas variantes que recuperen la capacidad de acumulación, tal como
ocurrió con B24 en Torrox, una variante parásita que derivó de B2 , una variante
neutralizada (Zurita y col., 1998). Por tanto, el ciclo comienza de nuevo cuando surge
una nueva variante parásita (con drive) que, posteriormente es neutralizada, como ha
ocurrido recientemente con B24 en Torrox (Perfectti y col., 2004). Estos cambios
sucesivos de Bs parásitos a neutros y de nuevo a parásitos, prolongan enormemente el
período de vida de los cromosomas B, tal como propusieron Camacho y col. (1997).
2.7. Efectos
La presencia de un B en un genoma hace que éste tenga mayor cantidad de ADN y que
además tenga que usar la maquinaria replicativa del genoma hospedador para replicarse
y transmitirse (Puertas, 2002; Jones y col., 2008). Así, el cromosoma B del pez A.
alburnus supone casi el 10% del tamaño de su genoma (Schmid y col., 2006) y el del
maíz incrementa la cantidad de ADN en el genoma un 4% (Jones y col., 2008). Por
tanto, es lógico pensar que toda esta cantidad extra de material biológico tenga efectos
sobre el genoma hospedador.
La mayoría de cromosomas B son heterocromáticos, y durante mucho tiempo
este hecho ha llevado a pensar que son genéticamente inertes. Sin embargo, cada vez
son más los estudios que revelan la existencia de actividad de genes ribosómicos,
pseudogenes, o de proteínas codificadoras localizados en los Bs. Por tanto, los efectos
encontrados, relacionados con la presencia de cromosomas B, en los individuos pueden
deberse a los productos génicos que provienen del propio B, como ocurre para los
genes de resistencia a la roya que tienen los Bs de Avena sativa (Dherawattana y
Sadanaga, 1973) y los de resistencia a antibióticos localizados en los Bs de Nectria
haematococca (Miao y col., 1991a, b), o bien derivar de su mera presencia en los
genomas, como aluden la mayoría de casos descritos en los que se ha estudiado los
efectos de los cromosomas B (Camacho y col., 2000). Un ejmplo de esta última
situación lo encontramos en la planta liliácea Scilla autumnalis, cuyos Bs tienen
45
influencia sobre la expresión de un gen de los As que codifica para una esterasa,
haciendo que las plantas con B expresen el gen E-1 y las sin B no (Ruiz-Rejón y col.,
1980; Oliver y col., 1982).
Los efectos de los Bs pueden afectar a procesos celulares y fisiológicos tanto en
plantas como animales. Estos efectos normalmente no son visibles fenotípicamente,
salvo en el caso de la planta Haplopappus gracilis, donde los Bs cambian el color de los
aquenios (Jackson y Newmark, 1960), o del maíz, donde las plantas con B tienen las
hojas rayadas (Staub, 1987). En la naturaleza encontramos con mucha más frecuencia
casos donde los Bs afectan negativamente a la vigorosidad, la fecundidad y fertilidad
de los individuos portadores, haciendo referencia a la naturaleza parasítica de estos
elementos genéticos. También es posible encontrar situaciones contrarias donde los
individuos con bajo número de Bs ven incrementado el vigor por el efecto de éstos
(Jones y Rees, 1982).
Otros efectos que se han descrito para los Bs son la alteración de los niveles de
expresión de las NORs de los cromosomas A de E. plorans (Cabrero y col., 1987),
siendo mayor en los individuos 1B que en los 0B, y la variación de la frecuencia de
quiasmas de los cromosomas del genoma hospedador. Atendiendo a éste último efecto,
se ha observado tanto un incremento de quiasmas (en la mayoría de los casos) como una
disminución o ausencia de efecto relacionado con la presencia de cromosomas B (Jones
y Rees, 1982; Bell y Burt, 1990). Como consecuencia de ésto, la existencia de
cromosomas B se interpretó inicialmente como un fenómeno adaptativo que hace que la
población evolucione más rápido debido al incremento de variabilidad genética (John y
Hewitt, 1965; Hewitt y John, 1967). Sin embargo, Bell y Burt (1990) criticaron esta
hipótesis ya que suponía que los Bs, a pesar de ser parásitos, eran seleccionados por sus
efectos favorables sobre el genoma hospedador, y propusieron otra que defendía que el
aumento de número de quiasmas y de la variabilidad genética de la descendencia son
una respuesta del genoma hospedador a la presencia del cromosoma B parásito (teoría
de la recombinación inducible). Camacho y col. (2002) apoyaron esta teoría y además
matizaron que era dependiente del estado del polimorfismo del B en cada población,
siendo mayor el número de quiasmas en los As cuanta más acumulación presentaba el
B.
3. Eyprepocnemis plorans
3.1. La especie
Eyprepocnemis plorans (Orthoptera, Acrididae) es una especie de saltamontes en la que
se han descrito cuatro subespecies: E. plorans plorans (Charpentier, 1825), E. plorans
ornatipes (Walter, 1870), E. plorans ibandana (Giglio-Tos, 1907) y E. plorans
meridionalis (Uvarov, 1921). E. plorans plorans (Figura 6) se distribuye por toda la
región circunmediterránea, llegando hasta el Cáucaso y la Península Arábiga (Dirsh,
1958). En España, se encuentra a lo largo de la costa mediterránea, desde Tarragona
hasta Huelva, adentrándose hacia regiones interiores a lo largo de las cuencas de los
46
Introducción general y Objetivos
principales ríos mediterráneos. Las otras tres subespecies se encuentran on diferentes
lugares del Africa (Dirsh, 1958). La subespecie empleada en el presente trabajo
corresponde a E. plorans plorans, y a ella nos referiremos de ahora en adelante con el
nombre de la especie.
Este saltamontes tiene una única generación anual, desde julio a marzo, con un
máximo de densidad poblacional en el mes de octubre para ambos sexos, siendo mayor
para los machos. En agosto podemos ya encontrar poblaciones de las primeras ninfas.
Es una especie polífaga poco exigente en su dieta, con cierta capacidad gregaria y
elevado poder de dispersión (Hernández y Presa, 1984), que vive preferentemente en
ambientes húmedos y muy cálidos (30°C). Su elevada tasa reproductiva y su capacidad
de descubrir las condiciones bióticas más favorables, le ha hecho en ocasiones una
especie dañina para los cultivos. Una vez recolectados individuos en el medio natural,
esta especie se puede cultivar en el laboratorio e incluso mantener el cultivo de un año
hasta el siguiente.
Figura 6. Espécimen de Eyprepocnemis plorans plorans.
3.2. El genoma
El complemento cromosómico de E. plorans tiene un tamaño aproximado de 10
picogramos, es decir de alrededor de 10 10 pb (Ruiz-Ruano y col., 2011) y está formado
por 11 pares de autosomas y un par sexual (Figura 7). El determinismo del sexo es del
tipo XX/X0, con lo que las hembras tienen dos cromosomas X y los machos solo uno.
Todos los cromosomas son acrocéntricos y se clasifican en tres grupos según su tamaño:
cromosomas largos (L 1 -L2), medianos (M3 -M8) y pequeños (S9 -S11). El cromosoma X
tiene un tamaño intermedio entre los cromosomas L2 y M3. Todos los autosomas y el
par sexual poseen ADNr, aunque existe variación entre poblaciones, situándose los
bloques mayores en los bivalentes S9, S10, S11 y X. En éstos se puede visualizar las
constricciones secundarias correspondientes a las NORs, y es en estos cromosomas
donde las encontramos recurrentemente activas.
47
Figura 7. Célula en diplotene correspondiente
a un macho de E. plorans de la población de
Torrox (Málaga) sometida a una tinción con orceína
lactopropiónica al 2% . En la foto se aprecia los 11
bivalentes, el cromosoma X y dos Bs.
La gran mayoría de las poblaciones españolas analizadas hasta ahora poseen
cromosomas B (Camacho y col., 1980; Henriques-Gil y col., 1984; Cabrero y col.,
1997; Riera y col., 2004) con la única excepción de las poblaciones situadas en las
cabeceras de los ríos de la cuenca del Segura (Cabrero y col., 1997). También contienen
cromosomas B las poblaciones analizadas en Marruecos (Bakkali, 2001), Italia (LópezFernández y col., 1992), Grecia (Abdelaziz y col., 2007), Turquía (López-León y col.,
2008), Armenia (López-León y col., 2008), Dagestan (Rusia) (Cabrero y col., 2003),
Tunez y Sicilia (Cabrero y col. 2013), y recientemente los hemos encontrado en Egipto.
Poblaciones de Sudáfrica, pertenecientes a la subespecie E. plorans meridionalis, sin
embargo, no poseen cromosomas B (López-León y col., 2008).
3.3. Los cromosomas B de E. plorans
El sistema de cromosomas B de E. plorans es uno de los más ampliamente estudiados
(véase Camacho, 2003). Los cromosomas B de esta especie se caracterizan por ser
mitóticamente estables en los tejidos gonadales masculinos y en los ciegos gástricos, es
decir, por presentar el mismo número de cromosomas B en cada célula. Otra
característica muy llamativa es que se han descrito más de 50 variantes citológicas de
Bs en esta especie (Henriques-Gil y col., 1984; López-León y col., 1993; Bakkali 2001;
López-León y col., 2008), coexistiendo algunas de ellas en la misma población. Estas
variantes difieren en tamaño y morfología mostrando variación en la proporción relativa
48
Introducción general y Objetivos
de las secuencias que lo componen (López-León y col., 1994; Cabrero y col., 1999). De
todas las variantes de B que existen en E. plorans, B1 es la más ampliamente distribuida
tanto en la Península Ibérica (en poblaciones de Murcia, Alicante e Islas Baleares entre
otras) como en Marruecos, por lo que es considerada la variante ancestral (HenriquesGil y Arana, 1990). B2 es la variante más común en Granada y Málaga oriental, B 5 es
predominante en Fuengirola (Málaga), y B 24 en Torrox (Málaga). El resto de variantes
aparecen con muy baja frecuencia. El número de cromosomas B que porta un individuo
también es variable, pudiendo coexistir en la misma población individuos sin
cromosoma B y otros con diferente número de Bs (se han descrito casos de hasta 6B en
el mismo macho).
Al igual que ocurre en la mayoría de especies, las diferentes variantes de Bs de
E. plorans están formados mayoritariamente por secuencias repetidas presentes también
en los cromosomas A: el ADNsat de 180pb (específico de E. plorans) y el ADNr 45S,
el cual constituye en este cromosoma el mayor bloque de esta secuencia en todo su
genoma. Se han observado diferencias en la composición relativa de estas dos
secuencias en los Bs no sólo entre variantes, sino también entre regiones geográficas.
Así, los Bs de las poblaciones del este de Europa (Cáucaso, Turquía y Grecia) tienen
mucha cantidad de ADNr 45S y poca de ADNsat de 180pb (Cabrero y col., 2003;
López-León y col., 2008), exceptuando el cromosoma B4a de Armenia que no porta
dichas secuencias (López-León y col., 2008). Por el contrario, las poblaciones del oeste
de Europa (España y Marruecos) tienen cromosomas B con aproximadamente la misma
cantidad de ambas secuencias, exceptuando B5 y B24 donde la proporción de ADNsat es
mayor que la de ADNr 45S (Cabrero y col., 1999; Bakkali, 2001; López-León y col.,
2008). Este hecho de diversificación de los Bs por zonas geográficas sugería que el
origen de los Bs de las poblaciones del este y del oeste de Europa es independiente.
Pero Muñoz-Pajares y col. (2011) consiguieron aislar un marcador específico del B
(SCAR) en poblaciones muy distantes como son Marruecos y Armenia cuya secuencia
estaba muy conservada, abogando por el origen común y reciente de todos los
cromosomas B de E.plorans.
El ciclo de vida de los Bs en esta especie sigue el modelo casi-neutro explicado
en el apartado 1.6. propuesto por Camacho y col. en 1997. En E. plorans, las variantes
B1, B2 y B5 se encontrarían en estadio evolutivo de neutralización ya que carecen de
mecanismos de acumulación y muestran tasas de transmisión próximas a 0,5 (LópezLeón y col., 1992a), debido probablemente a la existencia de genes supresores
localizados en los As. Sin embargo, la variante B 24 de la población de Torrox es de
aparición reciente. En esta población, la variante neutral B 2 ha sido sustituida por la
variante parasítica B24 (con acumulación) tras mutaciones cromosómicas que han hecho
que la nueva variante tenga más ADNsat y menos ADNr que la anterior. Esta nueva
variante se relacionó con un descenso de la fertilidad de los huevos pero aún así era
transmitido por las hembras con una frecuencia del 70% (Zurita y col., 1998). De
acuerdo con la dinámica evolutiva propuesta para los cromosomas B, la probable
actuación de genes supresores de la acumulación sobre el cromosoma B24 ha eliminado
la inicial capacidad de sobretransmisión de dicho B , neutralizándolo.
49
Los cromosomas B de E. plorans no tienen normalmente efectos sobre la
eficacia biológica de sus portadores, exceptuando la reducción significativa en la
fertilidad de los huevos producida por B24 en su fase parasítica (Zurita y col. 1998).
Estudios realizados en poblaciones de Granada con B 2 pusieron de manifiesto que esta
variante no tiene efectos sobre la frecuencia de cópula (López-León y col., 1992b), el
tamaño de la puesta, la fertilidad de los huevos ni la viabilidad desde el embrión hasta
adulto (Camacho y col., 1997). De ahí que se denomine a este tipo de Bs “casi-neutros”.
Debido a las secuencias altamente repetidas que portan, los cromosomas B son
heterocromáticos en esta especie. Durante mucho tiempo se pensó que el B de E.plorans
era genéticamente inactivo, hasta que Cabrero y col. (1987) encontraron un individuo
donde muchas de sus células en diplotene mostraban un nucleolo asociado a la región
distal del cromosoma B2 que se había fusionado con el autosoma más largo del
complemento. Tras este hallazgo, Teruel y col. (2007, 2009) estudiaron, mediante
impregnación argéntica, diplotenes de machos de la población de Torrox, y vieron que
la NOR del B24 aparecía recurrentemente activa. Además, analizaron el área nucleolar
de los diferentes cromosomas con NOR activa y encontraron que, tanto si el B estaba
activo como si no, el área nucleolar total de la célula permanecía constante. También
Teruel (2009) obtuvo las secuencias del cistrón de ADNr de individuos con y sin
cromosoma B, así como la localizada en los cromosomas X y B de E.plorans, previa
microdisección de estos dos tipos cromosómicos. Los resultados condujeron al hallazgo
de la inserción diferencial de una adenina en la ITS2 del ADNr amplificado a partir del
cromosoma B y que, por tanto, no aparecía en el resto de secuencias analizadas
correspondientes a los cromosomas A. Este hallazgo supuso realmente el inicio de la
presente tesis.
Referencias
Abdelaziz M, Teruel M, Chobanov D, Camacho JP, Cabrero J (2007) Physical mapping
of rDNA and satDNA in A and B chromosomes of the grasshopper
Eyprepocnemis plorans from a Greek population. Cytogenet Genome Res
119:143-6
Alper I, Frenette M, and Labrie S (2011) Ribosomal DNA polymorphisms in
the yeast Geotrichum candidum. Fungal Biol 115(12):1259-1269
Alvarez I, Wendel JF (2003) Ribosomal ITS sequences and plant phylogenetic
inference. Mol Phylogenet Evol 29:417-434
Amos A, Dover G (1981) The distribution of repetitive DNAs between regular and
supernumerary chromosomes in species of Glossina (Tsetse): a two-step process
in the origin of supernumeraries. Chromosoma 81:673-690
Averbeck KT, Eickbush TH (2005) Monitoring the mode and tempo of concerted
evolution in Drosophila melanogaster rDNA locus. Genetics 171:1837-1846
Bakkali M (2001) Tesis Doctoral: Evolución de los cromosomas B del saltamontes
Eyprepocnemis plorans en Marruecos. Universidad de Granada.
Bakkali M, Cabrero J, López-León MD, Perfectti F, Camacho JPM (1999) The B
chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North
Africa. I. B variants and frequency. Heredity 83:428-434
50
Introducción general y Objetivos
Bakkali M, Perfectti F, and Camacho JP M (2002) The B chromosome polymorphism
of the grasshopper Eyprepocnemis plorans in North Africa. II. Parasitic and
neutralized B1 chromosomes. Heredity 88:14-18
Bakkali M, Camacho, JPM (2004) The B chromosome polymorphism of the
grasshopper Eyprepocnemis plorans in North Africa: III. Mutation rate of B
chromosomes. Heredity 92:428-433
Baroni S, Lopes CE, de Almeida-Toledo LF (2009) Cytogenetic characterization of
Metynnis maculatus (Teleostei; Characiformes): the description in Serrasalminae
of a small B chromosome bearing inactive NOR-like sequences. Caryologia
62:95-101
Battaglia E (1964) Cytogenetics of B-chromosomes. Caryologia 17:245-299
Bell G, Burt A (1990) B chromosomes: germ-line parasites which induce changes in
host recombination. Parasitology 100:S19-S26
Beukeboom LW (1994a) Bewildering Bs: an impression of the 1st B-chromosome
conference. Heredity 73:328-336
Bidau CJ, Rosato M, Martí DA (2004) FISH detection of ribosomal cistrons and
assortment-distortion for X and B chromosomes in Dichroplus pratensis
(Acrididae). Cytogenet Genome Res 106:295-301
Bik HM, Fournier D, Sung W, Bergeron RD, Thomas WK (2013) Intra-Genomic
Variation in the Ribosomal Repeats of Nematodes. PLoS ONE 8(10): e78230.
doi:10.1371/journal.pone.0078230
Blaalid R, Carlsen TOR, Kumar S, Halvorsen R, Ugland KI, Fontana G, Kauserud H
(2012) Changes in the root-associated fungal communities along a primary
succession gradient analysed by 454 pyrosequencing. Molecular Ecology
21:1897-1908
Blaalid R, Kumar S, Nilsson RH, Abarenkov K, Kirk PM, Kauserud H (2013) ITS1
versus ITS2 as DNA metabarcodes for fungi. Molecular Ecology 21:1897-1908
Boeskorov GG, Kartavtseva IV, Zagorodniuk IV, Belianin AN, Liapunova EA (1995)
Nucleolus organizer regions and B-chromosomes of field mice (Mammalia,
Rodentia, Apodemus). Genetika 31(2):185-192
Boisvert FM, van Koningsbruggen S, Navascues J, Lamond AI (2007) The
multifunctional nucleolus. Nat Rev Mol Cell Biol 8:574-585
Boothroyd JC, Wang A, Campbell DA, Wang CC (1987) An unusually compact
ribosomal DNA repeat in the protozoan Giardia lamblia. Nucleic Acids Res
15:4065-4084
Bosemark NO (1954) On accessory chromosomes in Festuca pratensis. Hereditas
40:346-376
Boulon S, Westman BJ, Hutten S, Boisvert F-M, Lamond AI (2010) The nucleolus
under stress. Mol Cell 40:216-227
Boyes JM, Van Brink JM (1967) Chromosomes of Shyrpidae III. Karyotypes of some
species in the trihes Milesiini and Myoleptini. Chromosoma 22:417-455
Bridge PD, Spooner BM, Roberts PJ (2005) The impact of molecular data in fungal
systematics. Adv Bot Res 42:33-67
Brockhouse C, Bas JAB, Fereday RM, Strauss NA (1989) Supernumerary
chromosomes evolution in the Simulium vernum group (Diptera: Simulidae).
Genome 32:516-521
Brown DD, Wensink PC, Jordan E (1972) A comparison of the ribosomal DNA’s of
Xenopus laevis and Xenopus mulleri: the evolution of tandem genes. J Mol Biol
63:57-73
51
Burt A, Trivers R (2006) Genes in conflict: the biology of selfish genetic elements.
Belknap Press of Harvard University Press (Cambridge)
Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the
grasshopper Eyprepocnemis plorans on nucleolar organiser regions activity.
Activation of a latent NOR on a B chromosome fused to an autosome. Genome
29:116-121
Cabrero J, López-León MD, Gómez R, Castro AJ, Martín-Alganza A, Camacho JPM
(1997) Geographical distribution of B chromosomes in the grasshopper
Eyprepocnemis plorans, along a river basin, is mainly shaped by non-selective
historical events. Chromosome Res 5:194-198
Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999). Common origin of B
chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity
83:435-439
Cabrero J, Bakkali M., Bugrov,A, Warchalowska-Sliwa E, López-León MD, Perfectti
F, Camacho JPM (2003) Multiregional origin of B chromosomes in the
grasshopper Eyprepocnemis plorans. Chromosoma 112:207-211
Cabrero J, Bakkali M, Navarro-Domínguez B, Ruíz-Ruano FJ, Martín-Blázquez R,
López-León MD, Camacho JPM (2013) The Ku70 DNA-repair protein is
involved in centromere function in a grasshopper species. Chromosome Research
21:393-406
Camacho JPM, Shaw MW, López–León MD, Pardo MC, Cabrero J (1997) Population
dynamics of a selfish B chromosome neutralized by the standard genome in the
grasshopper Eyprepocnemis plorans. Am Nat 149:1030-1050
Camacho JPM, Carballo AR, Cabrero J (1980) The B-chromosome system of the
grasshopper Eyprepocnemis plorans subsp. plorans (Charpentier). Chromosoma
80:163-166
Camacho JPM, Sharbel TF, Beukeboom LW (2000) B chromo- some evolution. Phil
Trans R Soc Lond B 355:163-178
Camacho JPM, Bakkali M, Corral JM, Cabrero J, López-León MD, Aranda I, MartínAlganza A, Perfectti F (2002) Host recombination is dependent on the degree of
parasitism. Proc R Soc Lond Ser B 269:2173-2177
Camacho JPM, Cabrero J, López-León MD, Bakkali M, Perfectti F (2003) The B
chromosomes of the grasshopper Eyprepocnemis plorans and the intragenomic
conflict. Genetica 117:77-84
Camacho JPM (2005) B chromosomes. In: Gregory TR (ed) The evolution of the
genome. Academic Press, New York, pp 223-286
Cano MI, Santos JL (1989) Cytological basis of the B chromosome accumulation
mechanism in the grasshopper Heteracris littoralis (Ramb). Heredity 62:91-95
Carchilan M, Delgado M, Ribeiro T, Costa-Nunes P, Caperta A et al (2007)
Transcriptionally active heterochromatin in rye B chromosomes. Plant Cell
19:1738-1749
Carchilan M, Kumke K, Mikolajewski S, Houben A (2009) Rye B chromosomes are
weakly transcribed and might alter the transcriptional activity of A chromosome
sequences. Chromosoma 118:607-616
Charlesworth B, Langley CH, Stephan W (1986) The evolution of restricted
recombination and the accumulation of repeated DNA sequences. Genetics
112:947-962
Coleman AW (2003) ITS2 is a double-edged tool for eukaryote evolutionary
comparisons. Trends in Genetics 19:370-375
52
Introducción general y Objetivos
Crocker J, Boldy DA, Egan MJ (1989) How should we count AgNORs? Proposals for a
standardized approach. The Journal of pathology 158:185-188
Delany ME, Muscarella DE, Bloom SE (1994) Effects of rRNA gene copy number and
nucleolar variation on early development: inhibition of gastrulation in rDNAdeficient chick embryos. J Hered 85:211-217
Dammann R, Lucchini R, Koller T, Sogo JM (1995) Transcription in the yeast rRNA
gene locus: distribution of the active gene copies and chromatin structure of their
flanking regulatory sequences. Mol Cell Biol 15:5294-5303
Derenzini M, Nardi F, Farabegoli F, Ottinetti A, Roncaroli F, Bussolati G (1989)
Distribution of silver-stained interphase nucleolar organizer regions as a
parameter to distinguish neoplastic from nonneoplastic reactive cells in human
effusions. Acta Cytol 33:491-498
Derenzini M, Ploton D (1990) Interphase nucleolar organizer regions in cancer cells.
International review of experimental pathology 32:149-192
Derenzini M (2000) The AgNORs. Micron 31:117-120
Dhar MK, Friebe B, Koul AK, Gill BS (2002) Origin of an apparent B chromosome by
mutation, chromosome fragmentation and specific DNA sequence amplification.
Chromosoma 111:332-340
Dherawattana A, Sadanaga K (1973) Cytogenetics of a crown rust-resistant hexaploid
oat with 42+ 2 fragment chromosomes. Crop Science 13:591-594
Dirsh VM (1958) Revision of the genus Eyprepocnemis Fieber, 1853 (Orthoptera:
Acridoidea). Proc R Entomol Soc Lond 27:33-45
Eickbush DG, Eickbush TH, Werren JH (1992) Molecular characterization of repetitive
DNA sequences from a B chromosome. Chromosoma 101:575-583
Eickbush TH, Burke WD, Eickbush DG, Lathe WC (1997) Evolution of R1 and R2 in
the rDNA units of the genus Drosophila. Genetica 100(1-3):49-61
Eickbush TH, Eickbush DG (2007) Finely orchestrated movements: evolution of the
ribosomal RNA genes. Genetics 175(2):477-485
Feliner GN, Larena BG, a Aguilar JF (2004) Fine-scale geographical structure, intraindividual polymorphism and recombination in nuclear ribosomal internal
transcribed spacers in Armefia (Plumbaginaceae). Ann Bot 93:189-200
Fox DP, Hewitt GM, Hall DJ (1974) DNA replication and RNA transcription of
euchromatic and heterocromatic chromosome regions during grasshopper meiosis.
Chromosoma 45:43-62
Franks TK, Houben A, Leach CR, Timmis JN (1996) The molecular organisation of a B
chromosome tandem repeat sequence from Brachycome dichromosomatica.
Chromosoma 105(4):223-30
French SL, Osheim YN, Cioci F, Nomura M, Beyer AL (2003) In exponentially
growing Saccharomyces cerevisiae cells, rRNA synthesis is determined by the
summed RNA polymerase I loading rate rather than by the number of active
genes. Mol Cell Biol 23:1558-1568
Fröst S (1957) The inheritance of the accessory chromosomes in Centaurea scabiosa.
Hereditas 43:403-422
Gangloff S, Zou H, Rothstein R (1996) Gene conversion plays the major role in
controlling the stability of large tandem repeats in yeast. The EMBO Journal
15:1715-1725
Ganley ARD, Scott B (1998) Extraordinary ribosomal spacer length heterogeneity in a
Neotyphodium endophyte hybrid: Implications for concerted evolution. Genetics
150:1625-1637
53
Ganley ARD, Scott B (2002) Concerted evolution in the ribosomal RNA genes of an
Epichloë endophyte hybrid: Comparison between tandemly-arranged rDNA and
dispersed 5S rrn genes. Fungal Gene Bio 35:39-51
Ganley ARD, Kobayashi T (2007) Highly efficient concerted evolution in the ribosomal
DNA repeats: total rDNA repeat variation revealed by whole-genome shotgun
sequence data. Genome Research 17:184-191
Gébrane-Younès J, Fomproix N, Hernandez-Verdun D (1997) When rDNA
transcription is arrested during mitosis, UBF is still associated with noncondensed rDNA. J Cell Sci 110:2429-2440
Gojobori T, Nei M (1984) Concerted evolution of the immunoglobulin VH gene family.
Molecular biology and evolution 1:195-212
Goodpasture C, Bloom SE (1975) Visualization of nucleolar organizer regions in
mammalian chromosomes using silver staining. Chromosoma 53:37-50
Green DM (1988) Cytogenetics of the endemic New Zealand frog, Leiopelma
hochstetteri: extraordinary supernumerary chromosome variation and a unique
sex-chromosome system. Chromosoma 97:55-70
Green DM (1990) Muller's Ratchet and the evolution of supernumerary chromosomes.
Genome 33:818-824
Green DM, Zeyl CW, Sharbel TF (1993) The evolution of hypervariable sex and
supernumerary (B) chromosomes in the relict New Zealand frog, Leiopelma
hochstetteri. Journal of evolutionary biology 6:417-441
Grummt I (2013) The nucleolus, guardian of celular homeostasis and genome integrity.
Chromosoma. doi10.1007/s00412-013-0430-0
Gutknecht J, Sperlich D, Bachmann L (1995) A species specific satellite DNA family of
Drosophila subsilvestris appearing predominantly in B chromosomes.
Chromosoma 103:539-544
Hackstein JHP, Hochstenbach R, Hauschteck-Jungen E, Beukeboom LW (1996) Is the
Y chromosome of Drosophila an evolved supernumerary chromosome?
BioEssays 18:317-323
Hakansson A (1945) Überzählige chromosomen in einer rasse von Godetia nutans.
Hiorth Bot Notiser 2:1-19
Hakansson A (1948) Behaviour ol accessory rye chromosomes in the embryo-sac.
Hereditas 34:35-59
Heitz E (1931) Die Ursache der gesetzmässigen Zahl, Lage, From und Grösse
pflanzlicher Nukleolen. Planta 12:775-844
Henriques-Gil N, Santos JL, Arana P (1984) Evolution of a complex polymorphism in
the grasshopper Eyprepocnemis plorans. Chromosoma 89:290-293
Henriques-Gil N, Arana P (1990) Origin and substitution of B chromosomes in the
grasshopper Eyprepocnemis plorans. Evolution 44:747-753
Hernández F, Presa JJ (1984) Sobre la biología de Eyprepocnemis plorans (Charpentier,
1825) (Orthoptera: Acrididae), en la huerta de Murcia (S.E. España). Bol Serv
Plagas 10:245-249
Hernandez-Verdun D, Roussel P, Gébrane-Younès J (2002) Emerging concepts of
nucleolar assembly. J Cell Sci 115:2265-2270
Hernandez-Verdun D, Roussel P, Thiry M, Sirri V, Lafontaine DLJ (2010) The
nucleolus: structure/function relationship in RNA metabolism. Wires RNA 1:415431
Herrera JA, López-León MD, Cabrero J, Shaw MW, Camacho JPM (1996) Evidence
for B chromosome drive suppression in the grasshopper Eyprepocnemis plorans.
Heredity 76:633-639
54
Introducción general y Objetivos
Hewitt GM, John B (1967) The B-chromosome system of Myrmeleotettix maculatus
(Thunb.) III. The statistics. Chromosoma 21:140-162
Hewitt GM (1973a) The integration of supernumerary chromosomes into the orthopteran
genome. Cold Spring Harbour Symp Quant Bio 38:183-194
Hewitt GM (1976) Meiotic drive for B chromosomes in the primary oocytes of
Myrmeleotettix maculatus (Orthoptera: Acrididae). Chromosoma 56:381-391
Hewitt GM (1979) Grasshopper and crickets. In “Animal Cytogenetics”, vol. 3: Insecta
1 Orthoptera (ed. B. John), 170 pp. Berlin Stuttgart: Gebruder Borntraeger
Highett MI, Beven AF, Shaw PJ (1993) Localization of 5 S genes and transcripts in
Pisum sativum nuclei. J Cell Sci 105:1151-1158
Hiscox JA (2007) RNA viruses: hijacking the dynamic nucleolus. Nat Rev Microbiol
5:119-127
Holliday R (1987) The inheritance of epigenetic defects. Science 238:163-170
Horton TR, Bruns TD (2001) The molecular revolution in ectomycorrhizal ecology:
peeking into the black-box. Molecular Ecology 10:1855-1871
Hřibová E, Čížková J, Christelová P, Taudien S, de Langhe E, Doležel J (2011)
The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and use
in molecular phylogeny.
PLoS
One
6(3):e17863.
doi:
10.1371/journal.pone.0017863
Houben A, Kynast RG, Heim U, Hermann H, Jones RN, Forster JW (1996) Molecular
cytogenetic characterisation of the terminal heterochromatic segment of the B
chromosome of rye (Secale cereale). Chromosoma 105:97-103
Houben A, Belyaev ND, Leach CR, Timmis JN (1997) Differences of histone H4
acetylation and replication timing between A and B chromosomes of Brachycome
dichromosomatica. Chromosome Research 5:233-237
Huang S, Rothblum LI, Chen D (2006) Ribosomal chromatin organization. Biochem
Cell Biol 84:444-44
Hudson LA, Ciborowski JJH (1996) Teratogenic and genotoxic responses of larval
Chironomus salinarius group (Diptera: Chironimidae) to contaminated sediment.
Environ Toxicol Chem 15:1375-1381
Ide S, Miyazaki T, Maki H, Kobayashi T (2010) Abundance of ribosomal RNA gene
copies maintains genome integrity. Science 327:693-696
Ishak B, Jaafar H, Maetz JL, Rumpler Y (1991) Absence of transcriptional activity of
the B-chromosome of Apodemus peninsulae during pachytene. Chromosoma
100:278-281
Jackson RC, Newmark KP (1960) Effect of supernumerary chromosome on production
of pigment in Haplopappus gracilis. Science 132:1316-1317
James TC, Elgin SC (1986) Identification of a nonhistone chromosomal protein
associated with heterochromatin in Drosophila melanogaster and its gene. Mol
Cell Biol 6:3862-3872
James SA, O’Kelly MJT, Carter DM, Davey RP, Van Oudenaarden A, and Roberts IN
(2009) Repetitive sequence variation and dynamics in the ribosomal DNA array
of Saccharomyces cerevisiae as revealed by whole genome resequencing.
Genome Res 19:626-635
Jamilena M, Ruiz–Rejón C, Ruiz–Rejón M (1994) A molecular analysis of the origin of
the Crepis capillaris B chromosome. J. Cell Sci 107:703-708
Jamilena M, Garrido-Ramos M, Ruiz-Rejón M, Ruiz-Rejón , Parker JS (1995)
Characterisation of repeated sequences from microdissected of Crepis capillaris.
Chromosoma 104(2):113-120
55
Jimenez MM, Romera F, González-Sánchez M, Puertas MJ (1997) Genetic control of
the rate of transmission of rye B chromosomes. III. Male meiosis and
gametogenesis. Heredity 78:636-644
John B, Hewitt GM (1965) The B chromosome system of Myrmeleotettix maculatus
(Thunb.), I. The mechanics. Chromosoma 16:548-578
Jones RN, Rees H (1982) B chromosomes. New York: Academic Press
Jones RN, Puertas MJ (1993) The B-chromosomes of rye (Secale cereale L.).
In: Frontiers in Plant Science Research, eds. KK Dhir and TS Sareen. Delhi:
Bhagwati Enterprises, pp. 81-112
Jones RN (1995) Tansley review no. 85: B chromosomes in plants. New Phytol
131:411-434
Jones RN, Viegas W, Houben A (2008) A century of B chromosomes in plants: So
what? Annals of Botany 101:767-775
Kafatos FC, Orr W, Delidakis C (1985) Developmentally regulated gene amplification.
Trends in Genet 1:301-306
Kảrén O, Högberg N, Dahlberg A, Jonsson L, Nylund JE (1997) Inter-and intraspecific
variation in the ITS region of rDNA of ectomycorrhizal fungi in Fennoscandia as
detected by endonuclease analysis. New Phytologist 136:313-325
Kauserud H, Schumacher T (2002) Population structure of the endangered wood decay
fungus Phellinus nigrolimitatus (Basidiomycota). Canadian journal of botany
80:597-606
Kayano H (1957). Cytogenetic studies in Lillium callosum. III. Preferential segregation
of a supernumerary chromosome in EMCs. Proc Jap Acad 33:553-558
Kayano H (1971). Accumulation of B chromosomes in the germ-line of Locusta
migratoria. Heredity 27:119-123
Keller A, Förster F, Müller T, Dandekar T, Schultz J, Wolf M (2010) Including RNA
secondary structures improves accuracy and robustness in reconstruction of
phylogenetic trees. Biology Direct 5:4. doi: 10.1186/1745-6150-5-4
Kenton A (1991) Heterochromatin accumulation, disposition and diversity in Gibasis
karwinskyana (Commelinaceae). Chromosoma 100:467-478
Keyl HG, Hägele K (1971) B-Chromosomen bei Chironomus. Chromosoma 35:403-417
Ki JS, Han MS (2007) Cryptic long internal repeat sequences in the ribosomal DNA
ITS1 gene of the dinoflagellate Cochlodinium polykrikoides (dinophyceae): a 101
nucleotide six-repeat track with a palindrome-like structure. Genes and genetic
systems 82:161-166
Knibiehler B, Mirre C, Rosset R (1982) Nucleolar organizer structure and activity in a
nucleolus without fibrillar centres: the nucleolus in an established Drosophila cell
line. Journal of cell science 57:351-364
Knibiehler B, Mirre C, Navarro A, Rosset R (1984) Studies on chromatin organization
in a nucleolus without fibrillar centres. Cell and tissue research 236:279-288
Kobayashi T, Heck DJ, Nomura M, Horiuchi T (1998) Expansion and contraction of
ribosomal DNA repeats in Saccharomyces cerevisiae: requirement of replication
fork blocking (Fob1) protein and the role of RNA polymerase I. Genes and
development 12:3821-3830
Kobayashi T (2008) A new role of the rDNA and nucleolus in the nucleus--rDNA
instability maintains genome integrity. Bioessays 30:267-272
Kobayashi, T (2011) Regulation of ribosomal RNA gene copy number and its role in
modulating genome integrity and evolutionary adaptability in yeast. Cell Mol Life
Sci 68:1395-1403
56
Introducción general y Objetivos
Kovarik A, Pires JC, Leitch AR, Lim KY, Sherwood AM, Matyasek R, Rocca J, Soltis
DE, and Soltis, PS (2005) Rapid concerted evolution of nuclear ribosomal DNA
in two Tragopogon allopolyploids of recent and recurrent origin. Genetics
169:931-944
Kuwada Y (1915) Übe rdie Chromosomenzahl von Zea Mays L. Bot. Mag. Tôkyô
29:83-89
Langerstedt S (1949) Cytological studies on the protein metabolism of the liver in the
rat. Acta Anat Suppl 9:1–140
Lamb JC, Riddle NC, Cheng YM, Theuri J, Birchler JA (2007) Localization and
transcription of a retrotransposon-derived element on the maize B chromosome.
Chromosome research 15:383-398
Leach CR, Donald TM, Franks TK, Spiniello SS, Hanrahan CF, Timmis JN (1995)
Organisation and origin of a B chromosome centromeric sequence
from Brachycome dichromosomatica.Chromosoma 103(10):708-714
Leach CR, Houben A, Bruce F, Pistrick K, Demidov D et al (2005) Molecular evidence
for transcription of genes on a B chromosome in Crepis capillaris. Genetics
171:269-278
Li Y, Jiao L, and Yao YJ (2013) Non-concerted ITS evolution in fungi,
as revealed from the important medicinal fungus Ophiocordyceps sinensis. Mol
Phylogenet Evol 68(2):373-379
Liao D, Pavelitz T, Kidd JR, Kidd KK, Weiner AM (1997) Concerted evolution of the
tandemly repeated genes encoding human U2 snRNA (the RNU2 locus) involves
rapid intrachromosomal homogenization and rare interchromosomal gene
conversion. EMBO J 16:588-598
Lidner DL, Carlesen T, Henrik Nilsson R, Davey M, Schumacher T, Kauserud H (2013)
Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in
the internal transcribed spacer rDNA region in fungi. Ecol Evol 3(6):1751-1764
Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem 49:727764
López-Fernández C, Mezzanotte R, Gosálvez J (1992) Autosomal, sex and B
chromosomes in Eyprepocnemis plorans (Orthoptera) viewed with restriction
endonuclease in situ digestion. Heredity 68:365-372
López-León MD, Cabrero J, Camacho JPM (1991) A nucleolus organizer region in a B
chromosome inactivated by DNA methylation. Chromosoma 100:134-138
López-León MD, Cabrero J, Camacho JPM, Cano MI, Santos JL (1992a) A widespread
B chromosome polymorphism maintained without apparent drive. Evolution
46:529-539
López-León MD, Pardo MC, Cabrero J, Camacho JPM (1992b) Random mating and
absence of sexual selection for B chromosomes in two natural populations of the
grasshopper Eyprepocnemis plorans. Heredity 69:558-561
López–León MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL (1993)
Generating high variability of B chromosomes in the grasshopper Eyprepocnemis
plorans. Heredity 71:352-362
López-León MD, Neves N, Schwarzacher T, Heslop-Harrison TS, Hewitt GM,
Camacho JPM (1994). Possible origin of a B chromosome deduced from its DNA
composition using double FISH technique. Chromosome Res 2:87-92
López-León MD, Cabrero J, Camacho JPM (1995) Changes in DNA methylation during
development in the B chromosome NOR of the grasshopper Eyprepocnemis
plorans. Heredity 74:296-302
57
López-León MD, Cabrero J, Dzyubenko VV., Bugrov AG, Karamysheva TV, Rubtsov
NB, Camacho JPM (2008) Differences in ribosomal DNA distribution on A and B
chromosomes between eastern and western populations of the grasshopper
Eyprepocnemis plorans plorans. Cytogenet genome Res 121:260-265
Lucov Z, Nur U (1973) Accumulation of B-chromosomes by preferential segregation in
females of the grasshopper Melanoplus femur-rubrum. Chromosoma 42:289-306
Lyckegaard EM, Clark AG (1991) Evolution of ribosomal RNA gene copy number on
the sex chromosomes of Drosophila melanogaster. Mol Biol Evol 8(4):458-474
Martis MM, Klemme S, Banaei-Moghaddam AM, Blattner FR, Macas J, Schmutzer T,
Scholz U, Gundlach H, Wicker, T, Šimková H, Novák P, Neumann,P,
Kubaláková M, Bauer E, Haseneyer G, Fuchs J, Doležel J, Stein N, Mayer KFX,
Houben A (2012) Selfish supernumerary chromosome reveals its origin as a
mosaic of host genome and organellar sequences. Proc Natl Acad Sci USA
109:13343-13346
Maruyama S, Misumi O, Ishii Y, Asakawa S, Shimizu A, Sasaki T, Matsuzaki M, Shini
T, Nozaki H, Kohara Y (2004) The minimal eukaryotic ribosomal DNA units in
the primitive red alga Cyanidioschyzon merolae. DNA research 11:83-91
Mayol M, Rosselló JA (2001) Why nuclear ribosomal DNA spacers (ITS) tell different
stories in Quercus. Mol Phylogenet Evol 19:167-176
Matyášek R, Renny-Byfield S, Fulneček J, Macas J, Grandbastien MA, Nichols
R, Leitch A, Kovařík A (2012) Next generation sequencing analysis reveals a
relationship between rDNA unit diversity and locus number in Nicotiana diploids.
BMC genomics 13:722. doi: 10.1186/1471-2164-13-722
Mayer C, Grummt I (2005) Cellular Stress and Nucleolar Function. Cell Cycle
4(8):1036-1038
McAllister BF, Werren JH (1997) Hybrid origin of a B chromosome (PSR) in the
parasitic wasp Nasonia vitripennis. Chromosoma 106:243-253
McClintock DJL (1934) The relation of a particular chromosomal element to the
development of the nucleoli in Zea mays. Z Zellforsch Mikrosk Anat 21:294-328
McTaggart SJ, Dudycha JL, Omilian A, Crease TJ (2007) Rates of recombination in the
ribosomal DNA of apomictically propagated Daphnia obtusa lines. Genetics
175:311-320
Mestriner CA, Galetti PM, Valentini SR, Ruiz IR, Abel LD, Moreira-Filho O, Camacho
JPM (2000) Structural and functional evidence that a B chromosome in the
characid fish Astyanax scabripinnis is an isochromosome. Heredity 85:1.9
Miao VP, Covert SF, VanEtten HD (1991a) A fungal gene for antibiotic resistance on a
dispensable (‘B’) chromosome. Science 254:1773-1776
Miao VP, Matthews DE, VanEtten HD (1991b) Identification and chromosomal
locations of a family of cytochrome P-450 genes for pisatin detoxification in the
fungus Nectria haematococca. Mol Gen Genet 226:214-223
Montiel EE, Cabrero J, Camacho JPM, López-León MD (2012) Gypsy, RTE and
Mariner transposable elements populate Eyprepocnemis plorans genome.
Genetica 140:365-374
Mosgoeller W (2004) Nucleolar ultrastructure in vertebrates. In Olson MOJ, ed. The
Nucleolus. New York: Kluwer. pp 10-20
Müntzing A (1944) Cytological studies of extra fragment chromosomes in rye. I.
Isofragments produced by misdivision. Hereditas 30:231-248
Müntzing A (1948) Accessory chromosomes in Poa alpina. Herediy 2:4941
58
Introducción general y Objetivos
Muñoz-Pajares AJ, Martínez-Rodríguez L, Teruel M, Cabrero J, Camacho JPM,
Perfectti F (2011) A single, recent origin of the accessory B chromosome of the
grasshopper Eyprepocnemis plorans. Genetics 187:853-863
Nei M, Hughes AL (1991) in Evolution at the Molecular Level, eds. Selander R, Clark
A and Whittam T (Sinauer, Sunderland, MA), pp:222-247
Nei M, Hughes AL (1992) in 11th Histocompatibility Workshop and Conference, eds.
Tsuji K, Aizawa M and Sasazuki T (Oxford Univ. Press, Oxford), Vol. 2, pp:2738
Nei M, Gu X, Sitnikova T (1997) Evolution by the birth-and-death process in multigene
families of the vertebrate immune system. Proc Natl Acad Sci USA 94(15):77997806
Nei M, Rogozin IB, and Piontkivska H (2000) Purifying selection and birth-and-death
evolution in the ubiquitin gene family. Proc Natl Acad Sci USA 97(20):1086610871
Nemeth A, Guibert S, Tiwari VK, Ohlsson R, Langst G (2008) Epigenetic regulation of
TTF-I-mediated promoter–terminator interactions of rRNA genes. EMBO J
27:1255-1265
Nicklas RB (1961) Recurrent pole-to-pole movements of the sex chromosome during
prometaphase I in Melanoplus differentials spermatocytes. Chromosoma 12:97115
Nilsson RH, Kristiansson E, Ryberg M, Hallenberg N, Larsson KH (2008) Intraspecific
ITS variability in the kingdom Fungi as expressed in the international sequence
databases and its implications for molecular species identification. Evolutionary
bioinformatics online 4:193-201
Nur U (1963) A mitotically unstable supernumerary chromosome with an accumulation
mechanism in a grasshopper. Chromosoma 14:407-422
Nur U (1969) Mitotic instability leading to an acumulation of B-chromosomes in
grasshoppers. Chromosoma 27:1-19
Nur U (1977) Maintenance of a "parasitic" B chromosome in the grasshopper
Melanoplus femur–rubrum. Genetics 87:499-512
Nur U, Brett BLH (1985) Genotypes suppressing meiotic drive of a B chromosome in
the mealy bug Pseudococcus obscurus. Genetics 110:73-92
Nur U, Brett BLH (1988) Genotypes affecting the condensation and transmission of
heterochromatic B chromosomes in the mealy bug Pseudococcus affinis.
Chromosoma 96:205-212
Ochs RL, Lischwe MA, Shen E, Caroll RE, Busch H (1985) Nucleologenesis:
composition and fate of prenucleolar bodies. Chromosoma 92:330-336
Oliver JL, Posse F, Martínez-Zapater JM, Enriquez AM, Ruiz-Rejón M (1982) B
chromosomes and E1 isoenzyme activity in mosaic bulbs of Scilla autumnalis.
Chromosoma 85:399-403
Olson MOJ, Dundr M, Szebeni A (2000) The nucleolus: an old factory with unexpected
capabilities. Trends Cell Biol 10:189-96
Olson MOJ (2004) Sensing cellular stress: another new function for the nucleolus? Sci
STKE 2004(224):pe10
Ota T, Nei M (1994) Divergent evolution and evolution by the birth-and-death process
in the immunoglobulin VH gene family. Mol Biol Evol 11(3):469-482
Östergen G (1945) Parasitic nature of extra fragment chromosomes. Bot Notiser 2:157163
Pederson T, Tsai RY (2009) In search of nonribosomal nucleolar protein function and
regulation. J Cell Biol 184:771-776
59
Peppers JA, Wiggins LE, Baker RJ (1997) Nature of B chromosomes in the harvest
mouse Reithrodontomys megalotis by fluorescence in situ hybridization (FISH).
Chromosome Research 5:475-479
Perfectti F, Werren JH (2001) The interspecific origin of B chromosomes: experimental
evidence. Evolution 55:1069-1073
Perfectti F, Pita M, De La Vega CG, Gosálvez J, Camacho JPM (2004) Spatio-temporal
dynamics of a neutralized B chromosome in the grasshopper Eyprepocnemis
plorans. Cytogenet genome Res 106:376-385
Peters GB (1981) Germ line polysomy in the grasshopper Atractomorpha similis.
Chromosoma 81:593-617
Pettengill J, Neel M (2008) Phylogenetic patterns and conservation among North
American members of the genus Agalinis (Orobanchaceae). BMC evolutionary
biology 8:264
Pikaard CS (2000a) Nucleolar dominance: uniparental gene silencing on a
multimegabase scale in genetic hybrids. Plant Mol Biol 43:163-177
Pikaard CS (2000b) The epigenetics of nucleolar dominance. Trends in Genetics
16:495-500
Pilotti M, Brunetti B, Tizzani L (2009) Platanus×acerifolia genotypes surviving to
inoculation with Ceratocystis platani (the agent of canker stain): first screening
and molecular characterization. Euphytica 169:1-7
Poletto AB, Ferreira IA, Martins C (2010) The B chromosomes of the African cichlid
fish Haplochromis obliquidens harbour 18S rRNA gene copies. BMC Genet 11:1
Preuss S, Pikaard Cs (2007) rRNA gene silencing and nucleolar dominance: insights
into a chromosome-scale epigenetic on/off switch. Biochimica et Biophysica Acta
(BBA) Gene Structure and Expression 1769:383-392
Preuss SB, Costa-Nunes P, Tucker S, Pontes O, Lawrence RJ, Mosher R, Kasschau KD,
Carrington JC, Baulcombe DC, Viegas W, Pikaard CS (2008) Multimegabase
silencing in nucleolar dominance involves siRNA-directed DNA methylation and
specific methylcytosine-binding proteins. Mol Cell 32:673-684
Prokopowich CD, Gregory TR, Crease TJ (2000) The correlation between rDNA copy
number and genome size in eukaryotes. Genome 46:48-50
Puertas MJ (2002) Nature and evolution of B chromosomes in plants: A non-coding but
information-rich part of plant genomes. Cytogenet Genome Res 96:198-205
Randolph IF (1928) Types of supernumerary chromosornes in maize. Anat Rec 41. 102
Raška I, Shaw PJ, Cmarko D (2006a) New Insights into Nucleolar Architecture and
Activity. In: Kwang W Jeon (Ed.), International Review of Cytology. Academic
Press, pp:177-235
Raška I, Shaw PJ, Cmarko D (2006b) Structure and function of the nucleolus in the
spotlight. Current Opinion in Cell Biology 18:325-334
Rebollo E, Martin S, Manzanero S, Arana P (1998) Chromosomal strategies for
adaptation to univalency. Chromosome Res 6:515-532
Reeder RH (1985) Mechanisms of nucleolar dominance in animals and plants. The
Journal of cell biology 101:2013-2016
Reeder RH (1999) Regulation of RNA polymerase I transcription in yeast and
vertebrates. Prog Nucleic Acid Res Mol Biol 62:193-327
Reed KM, Beukeboom LW, Eickbush DG, Werren JH (1994) Junctions between
repetitive DNAs on the PSR chromosome of Nasonia vitripennis: association of
palindromes with recombination. Journal of molecular evolution 38:352-362
Ritossa FM (1968) Unstable redundancy of genes for ribosomal RNA. Proc Natl Acad
Sci USA 60:509-516
60
Introducción general y Objetivos
Rogers SO, Bendich AJ (1987) Ribosomal RNA genes in plants: variability in copy
number and in the intergenic spacer. Plant Molecular Biology 9:509-520
Roman H (1948) Directed fertilization in maize. Proc Natl Acad Sci USA 34:36.
Rooney AP, Ward TJ (2005) Evolution of a large ribosomal RNA multigene family in
filamentous fungi: Birth and death of a concerted evolution paradigm. Proc Natl
Acad Sci 102:5084-5089
Roussel P, Belenguer P, Amalric F, Hernandez-Verdun D (1992) Nucleolin is an AgNOR protein; this property is determined by its amino-terminal domain
independently of its phosphorylation state. Exp Cell Res 203:259-269
Roussel P, Hernandez-Verdun D (1994) Identification of Ag-NOR proteins, markers of
proliferation related to ribosomal gene activity. Exp Cell Res 214:465-472
Roussel P, Andre C, Comai L, Hernandez-Verdun D (1996) The rDNA transcription
machinery is assembled during mitosis in active NORs and absent in inactive
NORs. J Cell Biol 133:235-246
Rubbi CP, Milner J (2003) Disruption of the nucleolus mediates stabilization of p53 in
response to DNA damage and other stresses. The EMBO journal 22:6068-6077
Ruggero D, Pandolfi PP (2003) Does the ribosome translate cancer? Nature Reviews
Cancer 3:179-192
Ruiz-Rejón M, Posse F, Oliver JL (1980) The B chromosome system of Scilla
autumnalis (Liliaceae): Effects at the isozyme level. Chromosoma 79: 341-348
Ruiz-Ruano FJ, Ruiz-Estévez M, Rodríguez-Pérez J, López-Pino JL, Cabrero J,
Camacho JPM (2011) DNA amount of X and B chromosomes in the grasshoppers
Eyprepocnemis plorans and Locusta migratoria. Cytogenet genome Res
134:120-126
Rüschoff J, Plate KH, Contractor H, Kern S, Zimmermann R, Thomas C (1990)
Evaluation of nucleolus organizer regions (NORs) by automatic image analysis: a
contribution to standardization. The Journal of pathology 161:113-118
Sánchez-Gea J, Serrano J, Galián J (2000) Variability in rDNA loci in Iberian species of
the genus Zabrus (Coleoptera: Carabidae) detected by fluorescence in situ
hybridization. Genome 43:22-28
Santoro R, Li J, Grummt I (2002) The nucleolar remodeling complex NoRC mediates
heterochromatin formation and silencing of ribosomal gene transcription. Nature
genetics 32:393-396
Santos JL, Cerro AD, Fernández A, Díez M (1993) Meiotic behaviour of B
chromosomes in the grasshopper Omocestus burri: A case of drive in females.
Hereditas 118:139-143
Sapre AB, Deshpande DS (1987) Origin of B chromosomes in Coix L. through
spontaneous interspecific hybridization. Journal of Heredity 78:191-196
Schartl M, Wilde B, Schlupp I, Parzefall J (1995) Evolutionary origin of a
parthenoform, the Amazon molly Poecilia formosa, on the basis of a molecular
genealogy. Evolution 827-835
Schmid M, Ziegler CG, Steinlein C, Nanda I, Schartl M (2006) Cytogenetics of the
bleak (Alburnus alburnus), with special emphasis on the B chromosomes.
Chromosome Res 14:231-242
Smith GP (1973) Unequal crossover and the evolution of multigene families. Symposia
on Quantitative Biology, Vol. 38, pp:507-513
Schnare MN, Cook JR, Gray MW (1990) Fourteen internal transcribed spacers in the
circular ribosomal DNA of Euglena gracilis. Journal of molecular biology
215:85-91
61
Schoch CL, Seifert KA, Huhndorf S, Robert V, Spouge JL, Levesque CA, Chen W,
Bolchacova E, Voigt K, Crous PW (2012) Nuclear ribosomal internal transcribed
spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad
Sci USA 109:6241-6246
Seifert KA (2009) Progress towards DNA barcoding of fungi. Mol Ecol Resour 9
(Suppl.1):83-89
Sharbel TF, Green DM, Houben A (1998) B-chromosome origin in the endemic New
Zealand frog Leiopelma hochstetteri through sex chromosome devolution.
Genome 41:14-22
Shaw MW, Hewitt GM (1985) The genetic control of meiotic drive acting on the B
chromosome of Myrmeleotettix maculatus (Orthoptera: Acrididae). Heredity
54:259-268
Shaw PJ, Jordan EG (1995) The nucleolus. Annu Rev Cell Dev Biol 11:93-121
Simon UK, Weiss M (2008) Intragenomic variation of fungal ribosomal genes is higher
than previously thought. Mol Biol Evol 25(11):2251-2254
Sirri V, Roussel P, Hernandez-Verdun D (2000) The AgNOR proteins: qualitative and
quantitative changes during the cell cycle. Micron 31:121-126
Sirri V, Urcuqui-Inchima S, Roussel P, Hernandez-Verdun D (2008) Nucleolus: the
fascinating nuclear body. Histochem Cell Biol 129:13-31
Skalicka K, Lim KY, Matyásek R, Koukalová B, Leitch AR, Kovarìk A (2003) Rapid
evolution of parental rDNA in a synthetic tobacco allotetraploid line. Am J Bot
90: 988-996
Sollner-Webb B, Tower J (1986) Transcription of cloned eukaryotic ribosomal RNA
genes. Annu Rev Genet 55:801-830
Song HX, Gao SP, Jiang MY, Liu GL, Yu XF, Chen QB (2012) The evolution and
utility of ribosomal ITS sequences in Bambusinae and related species: divergence,
pseudogenes, and implications for phylogeny. J Genet 91:129-139
Stage DE, Eickbush TH (2007) Sequence variation within the rRNA gene loci of 12
Drosophila species. Genome Res 17(12):1888-1897
Staub RW (1987) Leaf striping correlated with the presence of B chromosomes in
maize. J Hered 78:71-74
Stephan W (1987) Quantitative variation and chromosomal location of satellite DNAs.
Genet Res 50:41-52
Stevens B (1985) The fine structure of the nucleolus during mitosis in the grasshopper
neuroblast cell. J Cell Biol 24:349-368
Stevens NM (1908) The chromosomes in Diabrotica vittata, Diabrotica soror and
Diabrotica punctata. A contribution to the literature on heterochromosomes and
sex determination. Journal of Experimental Zoology 5:453-470
Stewart FJ, Cavanaugh CM (2007) Intragenomic variation and evolution of the internal
transcribed spacer of the rRNA operon in bacteria. J Mol Evol 65(1):44-67
Stitou S, Zurita F, Díaz de la Guardia R, Jiménez R, Burgos M (2004) Transmission
analysis of B chromosomes in Rattus rattus from Northern Africa. Cytogenet
Genome Res 106: 344-346
Szostak JW, Wu R (1980) Unequal crossing over in the ribosomal DNA of
Saccharomyces cerevisiae. Nature 284:426-430
Talavera M, López-León MD, Cabrero J, Camacho JPM (1990) Male germ line
polysomy in the grasshopper Chorthippus binotatus: extra chromosomes are not
transmitted. Genome 33:384-388
62
Introducción general y Objetivos
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during
meiosis and NOR activity of a B chromosome in the grasshopper Eyprepocnemis
plorans. Chromosome Res 15:755-765
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR
expression in a B chromosome of the grasshopper Eyprepocnemis plorans.
Chromosoma 118:291-301
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromosome ancestry
revealed by histone genes in the migratory locust. Chromosoma 119: 217–225
Thiry M, Lamaye F, Lafontaine DL (2011) The nucleolus: when 2 became 3. Nucleus
2:289-293
Trerè D, Migaldi M, Trentini GP (1995) Higher reproducibility of morphometric
analysis over the counting method for interphase AgNOR quantification.
Analytical cellular pathology: the journal of the European Society for Analytical
Cellular Pathology 8:57
Trifonov VA, Dementyeva PV, Larkin DM, O’Brien PC, Perelman PL, Yang F,
Ferguson-Smith MA, Graphodatsky AS (2013) Transcription of a protein-coding
gene on B chromosomes of the Siberian roe deer (Capreolus pygargus). BMC
biology 11:1-11
Tsang CK, Bertram PG, Ai W, Drenan R, Zheng XF (2003) Chromatin-mediated
regulation of nucleolar structure and RNA Pol I localization by TOR. EMBO J
22:6045-6056
Tucker S, Vitins A, Pikaard CS (2010) Nucleolar dominance and ribosomal RNA gene
silencing. Current Opinion in Cell Biology 22:351-356
Van Heerikhuizen H, Ykema A, Klootwijk J, Gaillardin C, Ballas C, Fournier P (1985)
Heterogeneity in the ribosomal RNA genes of the yeast Yarrowia lipolytica;
cloning and analysis of two size classes of repeats. Gene 39:213-222
van Vugt JJFA, de Nooijer S, Stouthamer R, de Jong H (2005) NOR activity and repeat
sequences of the paternal sex ratio chromosome of the parasitoid wasp
Trichogramma kaykai. Chromosoma 114:410-419
Viseras E, Camacho JPM, Cano MI, Santos JL (1990) Relationship between mitotic
instability and accumulation of B chromosomes in males and females of Locusta
migratoria. Genome 33:23-29
Volkov RA, Komarova NY, Hemleben V (2007) Ribosomal DNA in plant hybrids:
inheritance, rearrangement, expression. Systematics and Biodiversity 5:261-276
Volobuev VT, Timina Ni (1980) Unusually high number of B-chromosomes and
mosaicism among them in the Asiatic forest mouse Apodemus peninsulae
(Rodentia, Muridae)]. Tsitol Genet 14(3):43-45
Vossbrinck CR, Woese CR (1986) Eukaryotic ribosomes that lack a 5.8S RNA. Nature
320:287-288
Vydryakova GA, Van DT, Shoukouhi P, Psurtseva NV, Bissett J (2012) Intergenomic
and intragenomic ITS sequence heterogeneity in Neonothopanus nambi
(Agaricales) from Vietnam. Mycology 3:89-99
Werren JH (1991) The paternal sex ratio chromosome of Nasonia. Am Nat 137:392-402
White MJD (1973) Animal Cytology and Evolution. 3rd ed. London: Cambridge
University Press.
Wilson EB (1907) The supernumerary chromosomes of Hemiptera. Science 26: 870871
Wolf KW, Mertl HG, Traut W (1991) Structure, mitotic and meiotic behaviour, and
stability of centromere-like elements devoid of chromosome arms in the fly
Megaselia scalaris (Phoridae). Chromosoma 101:99-108
63
Wörheide G, Nichols SA, Goldberg J (2004) Intragenomic variation of the
rDNA internal transcribed spacers in sponges (Phylum Porifera): implications for
phylogenetic studies. Mol Phylogenet Evol 33(3):816-830
Ziegler CG, Lamatsch DK, Steinlein C, Engel W, Schartl M, Schmid M (2003) The
giant B chromosome of the cyprinid fish Alburnus alburnus harbours a
retrotransposon-derived repetitive DNA sequence. Chromosome Res 11:23-35
Zimmer EA, Martin SL, Beverley SM, Kan YW, Wilson, AC (1980) Rapid duplication
and loss of genes coding for the alpha chains of hemoglobin. Proc Natl Acad Sci
USA 77: 2158-2162
Zurita S, Cabrero J, López-León MD, Camacho JPM (1998) Polymorphism
regeneration for a neutralized selfish B chromosome. Evolution 52:274-277
64
Introducción general y Objetivos
Objetivos
-
Objetivos generales:
1. Esta tesis doctoral tiene como objetivo general averiguar si la secuencia del ADN
ribosómico que albergan los cromosomas B del saltamontes Eyprepocnemis plorans
permite diferenciarlo del localizado en los cromosomas A y, en ese caso, averiguar si el
ARNr del B es funcional, en qué grado y en qué partes del cuerpo se expresa, así como
el significado biológico de los transcritos que aportan los cromosomas B. Para ello, nos
hemos propuesto analizar los siguientes objetivos específicos:
-
Objetivos específicos:
2. Desarrollar un método molecular para detectar molecularmente los transcritos
procedentes del ADNr de los cromosomas B, diseñando para ello cebadores y
programas de PCR específicos. Para probar el método, analizaremos citogenética y
molecularmente la expresión del ADNr del cromosoma B 24 en machos y hembras de la
población de Torrox (Málaga).
3. Caracterizar mediante doble FISH, con sondas de ADNr y ADNsat, los tipos de Bs
existentes en poblaciones de la región mediterránea occidental, con el fin de seleccionar
un grupo de poblaciones con diferentes tipos de cromosomas B (ver objetivo siguiente).
4. Averiguar si otros tipos de cromosomas B, además de B 24, expresan su ADNr y con qué
frecuencia. Para ello, analizaremos una serie de poblaciones españolas portadoras de
otras variantes tales como B1, B 2 y B5. Bajo la hipótesis de que los Bs son de origen
reciente en esta especie, cabría esperar que todas las variantes mantuviesen la capacidad
de expresar su ADNr. Analizaremos, por tanto, si éste está activo en las otras variantes y
en qué grado se expresa.
5. Averiguar si los cromosomas B están presentes en todas las partes del cuerpo de un
mismo individuo. Para ello, utilizaremos el método molecular desarrollado en el objetivo
1, y también un marcador molecular específico del B, desarrollado anteriormente.
6. Para averiguar si los cromosomas B de E. plorans son mitóticamente estables, es decir, si
se encuentran en el mismo número en todos los tejidos de un mismo individuo,
intentaremos cuantificar el número de copias del ADNr específico del cromosoma B en
diferentes machos de dos poblaciones diferentes, así como en diferentes partes del cuerpo
de varios individuos. Para ello, utilizaremos el método molecular anteriormente descrito
pero, en este caso, cambiando el cebador forward para que el fragmento amplificado sea
de menor tamaño y se ajuste así a los requerimientos técnicos de la PCR cuantitativa
(qPCR).
65
7. Averiguar si el ADNr de los cromosomas B se expresa en grados similares en diferentes
partes del cuerpo de los mismos individuos donde previamente hemos visualizado
citológicamente la formación de nucleolos por parte de los cromosomas B.
8. Para intentar averiguar las razones por las que el ADNr de los cromosomas B está
normalmente inactivo, intentaremos disminuir el nivel de expresión de HP1
(Heterochromatin Protein 1), mediante la técnica del ARNi (ARN de interferencia), y
analizaremos su incidencia sobre la cantidad de transcritos específicos del ADNr de los
cromosomas B, así como sobre la cantidad de ARNm para otras proteínas, y cualesquiera
efectos que puedan aparecer a los niveles citogenético y fenotípico.
9. Determinar si los cromosomas B contienen variantes específicas de la región ITS2 del
ADNr, y comparar su grado de expresión con otras variantes del genoma. Para ello,
realizaremos varios experimentos de secuenciación masiva (mediante pirosecuenciación
454 de Roche) de los amplicones previamente obtenidos mediante PCR con cebadores
anclados en las regiones codificadoras adyacentes.
66
Capítulo 2. B-Chromosome ribosomal DNA
is functional in the grasshopper
Eyprepocnemis plorans
67
68
B-Chromosome Ribosomal DNA Is Functional in the
Grasshopper Eyprepocnemis plorans
Mercedes Ruiz-Estévez, Ma Dolores López-León, Josefa Cabrero, Juan Pedro M. Camacho*
Departamento de Genética, Universidad de Granada, Granada, Spain
Abstract
B-chromosomes are frequently argued to be genetically inert elements, but activity for some particular genes has been
reported, especially for ribosomal RNA (rRNA) genes whose expression can easily be detected at the cytological level by the
visualization of their phenotypic expression, i.e., the nucleolus. The B24 chromosome in the grasshopper Eyprepocnemis
plorans frequently shows a nucleolus attached to it during meiotic prophase I. Here we show the presence of rRNA
transcripts that unequivocally came from the B24 chromosome. To detect these transcripts, we designed primers specifically
anchoring at the ITS-2 region, so that the reverse primer was complementary to the B chromosome DNA sequence
including a differential adenine insertion being absent in the ITS2 of A chromosomes. PCR analysis carried out on genomic
DNA showed amplification in B-carrying males but not in B-lacking ones. PCR analyses performed on complementary DNA
showed amplification in about half of B-carrying males. Joint cytological and molecular analysis performed on 34 B-carrying
males showed a close correspondence between the presence of B-specific transcripts and of nucleoli attached to the B
chromosome. In addition, the molecular analysis revealed activity of the B chromosome rDNA in 10 out of the 13 B-carrying
females analysed. Our results suggest that the nucleoli attached to B chromosomes are actively formed by expression of the
rDNA carried by them, and not by recruitment of nucleolar materials formed in A chromosome nucleolar organizing regions.
Therefore, B-chromosome rDNA in E. plorans is functional since it is actively transcribed to form the nucleolus attached to
the B chromosome. This demonstrates that some heterochromatic B chromosomes can harbour functional genes.
Citation: Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome Ribosomal DNA Is Functional in the Grasshopper Eyprepocnemis
plorans. PLoS ONE 7(5): e36600. doi:10.1371/journal.pone.0036600
Editor: Brian P. Chadwick, Florida State University, United States of America
Received March 2, 2012; Accepted April 9, 2012; Published May 3, 2012
Copyright: ß 2012 Ruiz-Estévez et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study was supported by a grant from the Spanish Ministerio de Ciencia e Innovación (CGL2009-11917), and was partially performed by FEDER
funds. M. Ruiz-Estévez was supported by a fellowship (FPU) from the Spanish Ministerio de Ciencia e Innovación. The funders had no role in study design, data
collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: jpmcamac@ugr.es
The size of the nucleolus is proportional to its biosynthetic activity
[11–17].
B chromosomes were considered genetically inert for long, since
experiments with tritiated uridine revealed its scarce incorporation
into B chromosomes in the grasshoppers Myrmeleotettix maculatus
and Chorthippus parallelus [18] and the mouse Apodemus peninsulae
[19]. In maize, B chromosomes are basically inert [20]. However,
indirect evidence for transcription from B chromosomes was
obtained in the toad Leiopelma hochstetteri [21] and the mosquito
Simulium juxtacrenobium [22]. Recently, evidence for a functional
role of B chromosomes on female sex determination has been
shown in cichlid fishes [23].
Some B chromosomes have been shown to carry a NOR being
able to organize nucleoli. For instance, in the grasshopper
Dichroplus pratensis, a B chromosome was frequently associated to
a nucleolus during meiosis [24], and it was later shown, by
fluorescent in situ hybridization (FISH), that it carries rDNA [25].
In many cases, however, the rDNA located on the B chromosomes
is inactive, as found, for instance, in the black rat Rattus rattus [26]
and the fish species Metynnis maculatus [27] and Haplochromis
obliquidens [28]. Especially puzzling is the case of the plant
Brachychome dichromosomatica, where large B chromosomes carrying
rRNA genes are often associated with a nucleolus at mitotic
prophase cells in root tips and in meiosis of pollen mother cells
[29], but these genes do not silver stain and no transcripts were
Introduction
B chromosomes constitute a bizarre part of the genomes in
about 15% of eukaryote species, being dispensable and frequently
harmful for carrier individuals, despite they sometimes reach high
population frequencies thanks to conspicuous mechanisms for
advantageous transmission (drive). The DNA contained into B
chromosomes is a broad panoply of repetitive sequences, including
satellite and microsatellite DNA, ribosomal DNA (rDNA) and
mobile elements [1]. Recently, the presence of H3 and H4 histone
genes has been shown in the B chromosomes of Locusta migratoria
[2].
The kind of repetitive DNA most frequently found in B
chromosomes is 45S rDNA [1,3,4]. It is located at chromosome
sites named nucleolus organizer regions (NORs) consisting of
tandemly repeated units composed of 18S, 5.8S and 28S rDNA,
separated by two internal transcribed spacers (ITS1 and ITS2)
and flanked by external transcribed spacers (ETS) and nontranscribed spacers (NTS) [5]. A cytologically visible phenotype
for these genes is the nucleolus, a nuclear membrane-free
compartment where ribosome components are synthesized [6].
It may easily be revealed in both interphase and meiotic cells
by silver impregnation [7]. This technique specifically reveals
the transcriptional machinery of RNA polimerase I, including
the B23, nucleolin, UBF and ARN Pol I subunits proteins [8–10].
PLoS ONE | www.plosone.org
1
69
May 2012 | Volume 7 | Issue 5 | e36600
A Functional B Chromosome
detected coming from them in leaves [30]. On the other hand, the
rare nucleolar association of micro B chromosomes suggests
inactivity of its 45S rDNA [31].
The first molecular evidence for gene activity on B chromosomes was found in the plant Crepis capillaris [32], specifically for
rDNA. In the parasitic wasp Trichogramma kaykai, NOR activity of
B chromosomes and presence of rRNA transcripts coming from
the Bs has also been reported [33]. In rye, it has recently been
shown the transcription of B-specific DNA sequences belonging to
high-copy number families with similarity to mobile elements [34].
In the grasshopper Eyprepocnemis plorans, FISH has shown that
most A chromosomes carry rDNA, although the highest amount is
actually found in the B chromosomes [35]. However, in most
cases, NOR activity is only observed in the three smallest
autosomes (9, 10 and 11) and the X chromosome, but not in the
B. Cabrero et al. [36] reported the presence of nucleoli associated
to a B chromosome that had fused to the longest autosome, in
strong contrast to non-fused Bs where such NOR activity had
never been found. It was later shown that rDNA is one of the
principal components of B chromosomes in this species [35], and
we have recently found a natural population where the rDNA in
the B24 chromosome is recurrently active, as deduced from the
presence of nucleoli attached to B chromosomes [37,38]. It was
unknown, however, whether those B-attached nucleoli are formed
in situ by expression of the B chromosome rDNA, or else by
recruitment of nucleolar material coming from other nucleolar
organizer regions (NORs), and therefore without expression of the
B rDNA. The main objective of the present research was to test for
these two alternatives by trying to detect rRNA transcripts that
undoubtedly had come from the B chromosome rDNA. For this
purpose, we used previous information provided by Teruel [39],
who determined the DNA sequence of the ITS1 and ITS2 of
rDNA coming from microdissected B24 chromosomes in E. plorans.
A comparison with the corresponding DNA sequence in the A
chromosomes, obtained from 0B individuals, revealed that most Bderived ITS2 sequences carried an inserted adenine which was
absent in all A-derived sequences [39]. This difference could thus
be used for identifying the rRNA transcripts coming from the B
chromosome. We then developed a PCR-based molecular method
to detect the B-rRNA transcripts in B-carrying males and, as a
cytological control, analysed the presence of nucleoli attached to B
chromosomes at diplotene. This molecular approach also
demonstrated to be useful to find B-rRNA transcripts in females.
Table 1. Number of B chromosomes in the 67 individuals
collected in the Torrox (Málaga, Spain) population of the
grasshopper Eyprepocnemis plorans.
Number of Bs == 2003
== 2004
RR 2007
== 2008
Total
0
-
-
10
10
20
1
-
1
2
19
21
2
1
-
11
5
18
3
1
2
-
4
7
4
-
-
-
1
1
Total
2
3
23
39
67
doi:10.1371/journal.pone.0036600.t001
1B, 23.7% in 2B and 26.9% in 3B males (Table 3), suggesting that
it does not depend on the number of B chromosomes. The
cytological analysis of the five B-carrying males collected in 2003
and 2004 showed nucleoli attached to Bs in all of them, since they
had been selected from a larger sample previously analysed [39].
The average frequency of diplotene cells showing B-attached
nucleoli in males showing B-NOR expression in the 2008 sample
(24.7% of 284 cells analysed in 14 males), did not differ from the
values previously observed in this same population (23.2% of 69
cells in 1999, 23.3% of 240 cells in 2003 and 19.5% of 380 cells in
2004) [37,38] (contingency x2 = 2.84, df = 3, P = 0.42).
Molecular analysis
In each individual, we performed PCR experiments with the
ITSA and ITSB primers on both genomic (gDNA) and
complementary (cDNA) DNA. The former served as a positive
control for the presence of the B-specific ITS2 with the inserted
adenine (ITS2_B), whereas the cDNA analysis tested the presence
of rRNA transcripts carrying the B-specific ITS2.
The PCR experiments on gDNA showed amplification in all Bcarrying males and females but not in any of the B-lacking ones
(Figure 2). Therefore, this PCR reaction shows the appropriate
specificity to reveal B chromosome (and ITS2_B) presence.
Results
Cytological analysis
Table 1 shows the number of B chromosomes observed in the
67 individuals analysed. Silver impregnation of diplotene cells
revealed the presence of nucleoli attached to B chromosomes in 14
out of the 29 B-carrying males collected in 2008 (Figure 1), but not
in the 15 remaining males (Table 2). Therefore, 48.3% of Bcarrying males showed NOR activity in the B chromosomes. This
figure did not differ from that reported by Teruel et al. [38] in a
sample from this same population collected in 2004, where 53% of
36 B-carrying males showed B-NOR activity (contingency
x2 = 0.02, df = 1, P = 0.89). This shows that the frequency of Bcarrying males showing NOR activity in the B chromosomes has
not significantly changed in these four years. As Table 2 shows, the
likelihood of showing NOR activity in a B chromosome increased
with B number, at least from 1–3 Bs, the exception being a single
4B male failing to show active Bs.
In the 14 males showing B-NOR activity, a rather regular
proportion of diplotene cells showed B-attached nucleoli: 23.3% in
70
PLoS ONE | www.plosone.org
Figure 1. Nucleolus formation by B chromosomes. Silver stained
diplotene cell showing nucleoli (nu) attached to a B bivalent (BB), the X
chromosome and autosomal bivalent no. 9. Bar = 10 m.
doi:10.1371/journal.pone.0036600.g001
2
May 2012 | Volume 7 | Issue 5 | e36600
A Functional B Chromosome
The joint cytological and molecular analysis performed in 34 Bcarrying males (also including five males collected in 2003 and
2004) revealed that 18 out of the 20 males showing ITS2_B
transcripts also showed nucleoli attached to B chromosomes in
diplotene cells, whereas the two remaining males (no. 43 and 72,
both with 1B) failed to show evidence of B-rDNA expression at the
cytological level. On the other hand, one male (no. 74) failed to
show the presence of the ITS2_B transcript but showed nucleoli
attached to Bs in two out of the 20 cells analysed (see Table 3).
Finally, 13 males showed absence of B-rDNA expression at both
cytological and molecular levels (Table 4). A contingency chisquare test performed to this 262 table showed a very strong
association between the presence of nucleoli attached to the B
chromosomes and the presence of the ITS2_B transcript
(x21 = 19.69, P,0.0001, with Yates’ correction).
Table 2. Frequency of B-carrying males from the 2008 sample
showing NOR activity in the B chromosomes, as deduced from
the presence of nucleoli attached to B chromosomes in
diplotene cells.
Males with
Number of Bs inactive Bs
Males with
active Bs
Total
% Males with
active Bs
1
13
6
19
31.6
2
1
4
5
80
3
0
4
4
100
4
1
0
1
0
Total
15
14
29
48.3
doi:10.1371/journal.pone.0036600.t002
Discussion
Cloning and sequencing of the obtained band revealed that it
corresponded to the expected ITS2_B region (Figure S1).
The PCR analysis on cDNA with the ITSA and ITSB primers
in B-lacking individuals, as a negative control, revealed no
amplification in both males and females (Figure 2), as expected
from the results of the PCR experiments on gDNA. However, the
molecular analysis of all B-carrying individuals (34 males and 13
females), showed that the ITS2_B transcript was present in the
cDNA of 20 of these males (9 with 1B, 4 with 2B and 7 with 3B)
but not in 14 of them (11 with 1B, 2 with 2B and 1 with 4B).
Likewise, 10 B-carrying females (2 with 1B and 8 with 2B) showed
the presence of the 484 bp ITS2_B transcript, whereas 3 females
with 2B failed to show it. The frequency of B-carrying individuals
showing ITS2_B transcripts was thus 58.8% in males and 76.9%
in females.
A number of evidences have shown that B chromosomes in the
grasshopper Eyprepocnemis plorans are sometimes attached to a
nucleolus, suggesting the possibility of expression of their rDNA.
In addition to previous evidences of NOR activity on B
chromosomes [36–39], our present cytological analysis, by means
of silver impregnation, in the 29 B-carrying males collected in this
same population, in 2008, has shown that the frequency of males
showing NOR activity in B chromosomes has not changed from
2004 to 2008, being close to 50%. In addition, the average
proportion of diplotene cells showing B-NOR activity seemed to
be rather stable (about 20%) from 1999 to 2008. This suggests that
the phenotypic expression of the ‘‘active B-NOR’’ trait shows high
temporal stability in this population. In contrast, expresivity of this
trait is highly variable among individuals, i.e. 5–50% (see Table 3).
Table 3. Proportion of diplotene cells showing nucleoli attached to B chromosomes in 14 B-carrying males collected in Torrox in
2008 and therefore showing NOR activity in the B chromosome.
No. of cells showing
% B-NOR activity
Number of Bs
Male no.
B-NOR inactivity
B-NOR activity
Total
1
54
10
10
20
50.0
49
14
6
20
30.0
58
16
4
20
20.0
67
15
5
20
25.0
52
19
1
20
5.0
45
18
2
20
10.0
Total:
92
28
120
23.3
74
18
2
20
10.0
61
14
6
20
30.0
63
15
5
20
25.0
55
12
8
20
40.0
Total:
59
21
80
23.7
62
15
9
24
37.5
50
13
7
20
35.0
42
17
3
20
15.0
2
3
71
16
4
20
20.0
Total:
61
23
84
26.9
212
72
284
24.7
Total
doi:10.1371/journal.pone.0036600.t003
PLoS ONE | www.plosone.org
3
71
May 2012 | Volume 7 | Issue 5 | e36600
A Functional B Chromosome
In males, we observed a very high correspondence between the
molecular and cytological analyses, i.e. the presence of the ITS2_B
transcripts, deduced from the PCR amplification of the 484 bp
fragment, and the existence of NOR activity in the B
chromosomes, deduced from the presence of nucleoli attached to
them. Presence of both evidences for B activity was observed in 18
males, and their absence in 13 males (see Table 4). The exceptions
were males no. 43, 72 and 74. In the two former, there were
ITS2_B transcripts but no nucleoli were found attached to the B
chromosomes at diplotene, whereas the reverse situation was
found in male no. 74, i.e. PCR experiments failed to show the
presence of the ITS2_B transcripts but two diplotene cells, out of
the 20 analysed, showed nucleoli attached to B chromosomes. This
indicates that both ways for ascertaining B-NOR activity (i.e.
cytological and molecular) may fail when the expression level is
low. The situation observed in males 43 and 72 could be explained
by early disorganization of nucleoli at diplotene, the existence of a
threshold for silver impregnation preventing nucleolus visualization when B-NOR expression is low, or else B activity in an organ
other than testes, since molecular analyses where performed in the
whole body excepting testes. The possibility of differences in BNOR expression among tissues of a same individual merits future
research. The absence of PCR amplification in male 74 might be
due to a very low number of ITS2_B transcripts which hampered
the final success of transcript detection. Alternatively, the
possibility exists that the nucleoli attached to the B chromosomes
and the molecular expression of the B rDNA do follow different
temporal schedules, since the nucleoli attached to Bs that were
observed at pachytene-diplotene were formed during leptotenezygotene, implying that the B-transcripts might have been
produced several days before nucleolus observation, so that it is
conceivable that a same male may, at a given time, show nucleoli
attached to their B chromosomes at pachytene but not ITS2_B
transcripts since its production had finished several days before.
In females, this correspondence cannot be tested since it is not
possible to analyse B-NOR expression cytologically. But the close
correspondence between cytological and molecular results,
observed in males, allow inferring B-NOR expression in females
through the PCR assay only. This showed the presence of the
484 bp fragment in 10 out of the 13 B-carrying females, suggesting
that the rRNA genes in the B24 chromosome are active in most
females, whereas it is active in only about half of males.
The active or inactive status of the rDNA in the B chromosome
may depend on epigenetic modifications such as DNA methylation
and/or histone methylation or acetylation. In E. plorans, the NOR
activity observed by Cabrero et al. [36] in the B2 chromosome
fused to the longest autosome was later shown to be related with
undermethylation of the rDNA [40]. In addition, it has been
shown that B chromosomes in this species are hypoacetylated for
lysine 9 in the H3 histone [41].
The role of B-derived rRNA transcripts and the mechanism of
transcription of the B repeats remain to be elucidated. A possibility
is that these transcripts might have structural functions in the
organization and regulation of the Bs themselves [42,43]. But, in
E. plorans, B chromosomes in the Torrox population might also
contribute to the total rRNA demanded by the cell, since the
activity of the B-NOR is associated with a decrease in the activity
of the NORs in the A chromosomes, so that total cell nucleolar
area does not change [37,38]. Unless the rDNA located in the B
chromosome would have preserved functionality, an increase in Bderived rRNA transcripts could lead to an increasing proportion of
abnormal rRNA copies that could be detrimental for the fitness of
B-carrying individuals. This possibility, however, needs further
research to determine the relative amount of the B-rRNA
Figure 2. Amplification of the ITS2_B region with the ITSA and
ITSB primers on genomic (gDNA) and complementary (cDNA)
DNA from representative males with 0–3 B chromosomes
(upper panel) and females with 0–2 B chromosomes (lower
panel). Note the presence of PCR product on gDNA of B-carrying
individuals but absence in the case of B-lacking ones. Also note the
presence of PCR product on cDNA of only some B-carrying individuals.
Ø = Negative control (with no DNA). C+ = Positive control (gDNA from
1B male).
doi:10.1371/journal.pone.0036600.g002
Although nucleoli are usually formed by expression of the
rDNA contained in the NOR to which they are attached [6], in
the case of non-standard genomic elements like parasitic B
chromosomes, the possibility exists that B chromosomes could
recruit nucleolar materials from other NORs without the need to
expressing their own rDNA. Our present results show that it is
possible to detect the presence of rRNA transcripts unequivocally
derived from the B chromosome in males showing nucleoli
attached to the B chromosome at diplotene cells. We designed
primers which specifically amplified a 484 bp region of the ITS2
rDNA in the B chromosome, on the basis of an adenine insertion
being exclusive of the B24 chromosome rDNA [39]. PCR
amplification with these primers was negative on gDNA in all
20 B-lacking individuals (10 males and 10 females) analysed.
However, it was positive on gDNA from all B-carrying individuals
analysed (34 males and 13 females), thus showing the high
specificity of this reaction for the B chromosome rDNA. When the
same assay was performed on cDNA, no amplification was
observed in 0B individuals. In B-carrying individuals, however, the
484 bp fragment was obtained in some individuals, suggesting that
the B chromosome rDNA is facultatively active.
Table 4. Joint cytological and molecular analysis of B
chromosome NOR expression in 34 males of the grasshopper
E. plorans.
Nucleolus attached to the B
chromosome
Molecular detection of the
ITS2_B transcript
+
+
18
2
2
1
13
2
doi:10.1371/journal.pone.0036600.t004
72
PLoS ONE | www.plosone.org
4
May 2012 | Volume 7 | Issue 5 | e36600
A Functional B Chromosome
with important ontogenetic processes such as, for instance, sex
determination [23].
transcripts (in respect to those derived from the A chromosomes)
and whether the B-rRNA transcripts are completely functional.
Given that total cell nucleolar area in B-carrying males does not
change despite B chromosome contribution to nucleolus formation, Teruel et al. suggested that cell regulation of rRNA demands
should lead to a decrease in the nucleolar area contributed by the
A chromosomes [37,38]. Therefore, the presence of rDNA in the
B chromosome of E. plorans seems to have implications for the
regulation of rDNA expression and its relationship with the
genomic amount of this kind of repetitive DNA. Ide et al. have
recently suggested that the presence of many copies of rDNA,
many of which are transcriptionally inactive, makes genomes less
sensitive to DNA damage, because the extra copies facilitate
recombinational repair [44]. As shown by these authors, the lower
DNA sensivity in yeast strains with high copy number depends on
a lower ratio of transcribed rRNA genes than that in strains with
low copy number whose rRNA genes are up-regulated. On this
basis, the fact that B-NOR activity in E. plorans does not change
total cell nucleolar area [37,38] might be the result of a rigid A
genome control on rDNA expression, perhaps because excessive
activity would decrease individual fitness through a lower
protection against DNA-damaging agents. Similar reasons would
explain why the grasshopper Stauroderus scalaris carries large
amounts of rDNA in all chromosomes but only those in
chromosome 3 are active [45].
The case of nucleolar expression in the B chromosomes of E.
plorans resembles nucleolar dominance, a phenomenon usually
observed in interspecific hybrids, by which the rDNA clusters from
one of the parental species are active whereas those from the other
parental species are inactive [46]. Nucleolar dominance seems to
be reversible since, in some individuals, the silenced rDNA can be
reactivated under certain conditions, e.g. in developmental stages
demanding more ribosomal synthesis [47]. In E. plorans, the rDNA
located in the B2 chromosome is usually silenced [48] whereas that
in the three smallest autosomes and the X chromosome is active in
a variable proportion of diplotene cells in all males [49]. The B24
chromosome arose from B2 and replaced it in the Torrox
population during the 1980’s [50], from where it is currently
expanding towards the west [51] and the east [52]. In the last
years, for unknown reasons, the rDNA in the B24 chromosome has
been derepressed since, in 1999, it showed NOR activity in 31% of
males [37], and this figure increased to about 40% in 2003–2004
[38] and 48.3% in 2008 (this paper, Table 2). Therefore, it seems
that the ‘‘active B-NOR’’ phenotype is increasing in frequency in
this population. Remarkably, however, the proportion of diplotene
cells showing the phenotype in B-carrying males was about the
same in 1B, 2B and 3B males, thus showing no odd-even pattern
for this trait, in contrast to many B chromosome effects (see [53]).
The B24 chromosome thus constitutes excellent material to
analyse the regulation of rDNA expression at intragenomic level,
and the PCR assay described here could contribute significantly to
this task because it permits to analyse B-rDNA expression in every
cell type, tissue and organ at every developmental stage where
RNA can be isolated. Likewise, it permits to test for B-rDNA
expression in other populations harbouring other B variants,
which is crucial for understanding the biological role of these B
chromosomes. B24 showed significant drive in 1992, i.e. when it
was finishing the replacement of B2 in Torrox [50], but a few years
later it had lost drive [54]. The recurrent expression of its rDNA
could thus be a new pathway for B24 evolution in this species, since
it is contributing to an important host function, i.e. rRNA
production. It also suggests that B chromosomes are not as
genetically inert as was previously thought, and they may even
contain some protein-coding genes whose expression can interfere
PLoS ONE | www.plosone.org
Materials and Methods
Experimental material
A total of 67 males and females of the grasshopper Eyprepocnemis
plorans were collected in Torrox (Málaga, Spain) in 2003, 2004,
2007 and 2008 (Table 1). For cytological analysis, males and
females were anaesthetized before dissecting out testes and
ovarioles, respectively, which were then fixed in freshly prepared
3 1 ethanol-acetic acid and stored at 4uC. Ovarioles were
immersed in 5% colchicine in insect saline solution for 3 hours
prior to fixation. For molecular analysis, body remains were frozen
in liquid nitrogen and stored at 280uC prior to DNA and RNA
isolation.
Cytological analysis of B-NOR expression
The number of B chromosomes in each individual was
determined in 2% lactopropionic orcein squash preparations.
Cytological evidence for the activity of the B chromosome NOR
was obtained from the presence of nucleoli attached to B
chromosomes in diplotene cells. For this purpose, testis preparations were submitted to the silver impregnation technique [7]
following the procedure described in [55]. These preparations
were additionally stained with 1% Giemsa to differentiate the
chromatin (blue) from the nucleoli (yellow to deep brown)
(Figure 1). At least twenty diplotene cells per male were analysed.
Cells were photographed with an Olympus digital camera (DP70).
Molecular analysis of B-NOR expression
A total of 44 males (10 with 0B, 20 with 1B, 6 with 2B, 7 with
3B and 1 with 4B) and 23 females (10 with 0B, 2 with 1B and 11
with 2B) were analyzed at the molecular level. Each individual
body was divided into two hemibodies, each of which was used for
genomic DNA and total RNA isolation. Genomic DNA extraction
was performed using GenElute Mammalian Genomic DNA
Miniprep (Sigma), following manufacturer’s recommendations.
Total RNA was extracted with Real Total RNA spin plus
(Real), following manufacturer’s recommendations, except increasing DNase I treatment up to 20 units to ensure complete
removal of any possible contaminating genomic DNA. After a
second cleaning with DNase I, we assessed the quality of the
isolated RNA by electroforesis in a MOPS (3-N-morpholinopropanesulfonic acid) denaturing agarose gel, based on the presence
of the 28S and 18S ribosomal RNA bands and the absence of low
molecular weight fragments.
For PCR experiments on genomic (gDNA) and complementary
(cDNA) DNA, a primer pair (ITSA and ITSB) was designed on the
basis of the ITS2 sequences reported by M. Teruel (accession
numbers: JN811827–JN811836 for 0B individuals, and
JN811886–JN811902 for microdissected B chromosomes), who
showed that an adenine insertion was present only in rDNA
obtained from microdissected B chromosomes but was absent in
rDNA sequences from 0B individuals [39]. We thus anchored the
reverse (ITSB) primer in the ITS2 region including this adenine.
PCR reaction with the ‘‘forward ITSA (59 TGGAGCCGTACGACGAAGTG 39)’’ and ‘‘reverse ITSB (59CGTTGTACGAAAGAGTTTGAG 39)’’ primers was adjusted to yield a 484 bp DNA
fragment from the desired ITS2 region, only in presence of the
inserted adenine in the template (complementary to the underlined
T in the ITSB primer). PCR mixture consisted of 200 mM dNTPs,
10 mM each primer, 20 ng genomic DNA and one unit of Taq
polymerase (New England, BioLabs) with 16 buffer in a final
5
73
May 2012 | Volume 7 | Issue 5 | e36600
A Functional B Chromosome
volume of 25 ml. PCR conditions were the following: an initial
denaturation at 94uC for 5 min and 30 cycles of 94uC for 30 s,
62,5uC for 40 s, 72uC for 45 s and final extension of 72uC for
7 min. PCR products were visualized in an electrophoresis 1.5%
agarose gel and the amplified fragment was cloned into TOPO
TA vector (Invitrogen) and subsequently sequenced in both
directions (Macrogen). Searching for sequence homology in
databases was performed using BLAST (Basic Local Alignment
Search tool) at NCBI site. Alignments were performed with
Bioedit software (version 7.0.9.0).
Complementary DNA (cDNA) was synthesized from total RNA
with SuperScript III First-Strand Synthesis SuperMix (Invitrogen),
following manufacturer’s protocol, and it was used as template for
PCR experiments with the ITSA and ITSB primers. PCR
reactions on cDNA contained 2000 mM dNTPs, 10 mM of each
primer, 1U Taq polymerase (New England, BioLabs) and 30 ng
cDNA. PCR conditions were as follows: initial denaturation at
94uC for 5 min, 30 cycles of 94uC for 30 s, 62,5uC (males) and
62,7uC (females) for 40 s, 72uC for 45 s and a final extension of
72uC for 7 min. Analysis of PCR products, cloning of amplified
fragments, DNA sequencing and homology search in the
databases were performed as for genomic DNA (see above).
Supporting Information
Figure S1 Nucleotide sequence of the DNA amplified with the
ITS2A and ITS2B primers.
(DOC)
Acknowledgments
We thank Marı́a Teruel for providing some materials.
Author Contributions
Conceived and designed the experiments: MRE MDLL JC JPMC.
Performed the experiments: MRE JC MDLL. Analyzed the data: MRE
MDLL JC JPMC. Contributed reagents/materials/analysis tools: MDLL
JC. Wrote the paper: MRE MDLL JC JPMC.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Camacho JPM (2005) B chromosomes. In: Gregory TR, ed. The evolution of
the genome. New York: Academic Press. pp 223–286.
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromosome ancestry
revealed by histone genes in the migratory locust. Chromosoma 119: 217–225.
Green DM (1990) Muller’s Ratchet and the evolution of supernumerary
chromosomes. Genome 33: 818–824.
Jones RN (1995) Tansley review no. 85: B chromosomes in plants. New Phytol
131: 411–434.
Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem
49: 727–764.
Carmo-Fonseca M, Mendes-Soares L, Campos I (2000) To be or not to be in the
nucleolus. Nat Cell Biol 2: E107–E112.
Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver staining
procedure for the localization of nucleolus and nucleolar organizer under light
and electron microscopy. Arch Biol 93: 267–274.
Roussel P, Belenguer P, Amalric F, Hernandez-Verdun D (1992) Nucleolin is an
Ag-NOR protein; this property is determined by its amino-terminal domain
independently of its phosphorylation state. Exp Cell Res 203: 259–269.
Roussel P, Hernandez-Verdun D (1994) Identification of Ag-NOR proteins,
markers of proliferation related to ribosomal gene activity. Exp Cell Res 214:
465–472.
Roussel P, Andre C, Comai L, Hernandez-Verdun D (1996) The rDNA
transcription machinery is assembled during mitosis in active NORs and absent
in inactive NORs. J Cell Biol 133: 235–246.
Caspersson T (1950) Cell growth and cell function, a cytochemical study. New
York: WW Norton and Co, Inc.
Busch H, Daskal Y, Gyorkey F, Smetana K (1979) Silver staining of nucleolar
granules in tumor cells. Cancer Res 39: 857–863.
Okabe Y, Nakamura S, Okumura H, Matano S, Kobayashi K, et al. (1991) The
relation of argyrophilic proteins of nucleolar organizer regions (AgNORs) to the
proportions of Ki-67 or DNA polymerase a9-reacting cells in non-Hodgkin’s
lymphomas. Anticancer Res 11: 2031–2035.
Thiele J, Fischer R (1993) Bone marrow tissue and proliferation markers: results
and general problems. Virchows Arch A 423: 409–416.
Busch H (1997) Nucleolar and nucleolonemal proteins of cancer cells. J Tumor
Marker Oncol 12: 5–68.
Nakamoto K, Ito A, Watabe K, Koma Y, Asada H, et al. (2001) Increased
expression of a nucleolar Nop5/Sik family member in metastatic melanoma
cells: evidence for its role in nucleolar sizing and function. Am J Pathol 159:
1363–1374.
Mosgoeller W (2004) Nucleolar ultrastructure in vertebrates. In Olson MOJ, ed.
The Nucleolus. New York: Kluwer. pp 10–20.
Fox DP, Hewitt GM, Hall DJ (1974) DNA replication and RNA transcription of
euchromatic and heterocromatic chromosome regions during grasshopper
meiosis. Chromosoma 45: 43–62.
Ishak B, Jaafar H, Maetz JL, Rumpler Y (1991) Absence of transcriptional
activity of the B-chromosome of Apodemus peninsulae during pachytene.
Chromosoma 100: 278–281.
Carlson WR (1986) The B chromosome of maize. CRC Crit Rev Plant Sci 3:
201–226.
Green DM (1988) Cytogenetics of the endemic New Zeland frog, Leiopelma
hochstetteri: extraordinary supernumerary chromosome variation and a unique
sex-chromosome system. Chromosoma 97: 55–70.
Brockhouse C, Bas JAB, Fereday RM, Strauss NA (1989) Supernumerary
chromosomes evolution in the Simulium vernum group (Diptera: Simulidae).
Genome 32: 516–521.
74
PLoS ONE | www.plosone.org
23. Yoshida K, Terai Y, Mizoiri S, Aibara M, Nishihara H, et al. (2011) B
chromosomes have a functional effect on female sex determination in lake
Victoria cichlid fishes. PLoS Genet 7(8): e1002203. doi:10.1371/journal.pgen.1002203.
24. Bidau CJ (1986) A nucleolar-organizing B chromosome showing segregationdistortion in the grasshopper Dichroplus pratensis (Melanoplinae, Acrididae).
Can J Genet Cytol 28: 138–148.
25. Bidau CJ, Rosato M, Martı́ DA (2004) FISH detection of ribosomal cistrons and
assortment-distortion for X and B chromosomes in Dichroplus pratensis
(Acrididae). Cytogenet Genome Res 106: 295–301.
26. Stitou S, Zurita F, Dı́az de la Guardia R, Jiménez R, Burgos M (2004)
Transmission analysis of B chromosomes in Rattus rattus from Northern Africa.
Cytogenet Genome Res 106: 344–346.
27. Baroni S, Lopes CE, de Almeida-Toledo LF (2009) Cytogenetic characterization
of Metynnis maculatus (Teleostei; Characiformes): the description in Serrasalminae
of a small B chromosome bearing inactive NOR-like sequences. Caryologia 62:
95–101.
28. Poletto AB, Ferreira IA, Martins C (2010) The B chromosomes of the African
cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies. BMC Genet
11: 1.
29. Donald TM, Leach CR, Clough A, Timmis JN (1995) Ribosomal RNA genes
and the B chromosome of Brachycome dichromosomatica. Heredity 74: 556–561.
30. Donald TM, Houben A, Leach CR, Timmis JN (1997) Ribosomal RNA genes
specific to the B chromosomes in Brachycome dichromosomatica are not transcribed
in leaf tissue. Genome 40: 674–681.
31. Marschner S, Meister A, Blattner FR, Houben A (2007) Evolution and function
of B chromosome 45S rDNA sequences in Brachycome dichromosomatica. Genome
50: 638–644.
32. Leach CR, Houben A, Bruce F, Pistrick K, Demidov D, et al. (2005) Molecular
evidence for transcription of genes on a B chromosome in Crepis capillaris.
Genetics 171: 269–278.
33. van Vugt JJFA, de Nooijer S, Stouthamer R, de Jong H (2005) NOR activity
and repeat sequences of the paternal sex ratio chromosome of the parasitoid
wasp Trichogramma kaykai. Chromosoma 114: 410–419.
34. Carchilan M, Kumke K, Mikolajewski S, Houben A (2009) Rye B chromosomes
are weakly transcribed and might alter the transcriptional activity of A
chromosome sequences. Chromosoma 118: 607–616.
35. López-León MD, Neves N, Schwarzacher T, Heslop-Harrison JS, Hewitt GM,
et al. (1994) Possible origin of a B chromosome deduced from its DNA
composition using double FISH technique. Chromosome Res 2: 87–92.
36. Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the
grasshopper Eyprepocnemis plorans on nucleolar organizer regions activity.
Activation of a latent NOR on a B chromosome fused to an autosome.
Genome 29: 116–121.
37. Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation
during meiosis and NOR activity of a B chromosome in the grasshopper
Eyprepocnemis plorans. Chromosome Res 15: 755–765.
38. Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of
NOR expression in a B chromosome of the grasshopper Eyprepocnemis plorans.
Chromosoma 118: 291–301.
39. Teruel M (2009) Origen, expresión y efectos fenotı́picos de un parásito
genómico. PhD. Universidad de Granada.
40. López-León MD, Cabrero J, Camacho JPM (1991) A nucleolus organizer region
in a B chromosome inactivated by DNA methylation. Chromosoma 100:
134–138.
6
May 2012 | Volume 7 | Issue 5 | e36600
A Functional B Chromosome
41. Cabrero J, Teruel M, Carmona FD, Jiménez R, Camacho JPM (2007) Histone
H3 lysine 9 acetylation pattern suggests that X and B chromosomes are silenced
during entire male meiosis in a grasshopper. Cytogenet Genome Res 119:
135–142.
42. Carchilan M, Delgado M, Ribeiro T, Costa-Nunes P, Caperta A, et al. (2007)
Transcriptionally active heterochromatin in rye B chromosomes. Plant Cell 19:
1738–1749.
43. Han F, Lamb JC, Yu W, Gao Z, Birchler JA (2007) Centromere function and
nondisjunction are independent components of the maize B chromosome
accumulation mechanism. Plant Cell 19: 524–533.
44. Ide S, Miyazaki T, Maki H, Kobayashi T (2010) Abundance of ribosomal RNA
gene copies maintains genome integrity. Science 327: 693–696.
45. López-León MD, Cabrero J, Camacho JPM (1999) Unusually high amount of
inactive ribosomal DNA in the grasshopper Stauroderus scalaris. Chromosome Res
7: 83–88.
46. Pikaard CS (2000) The epigenetics of nucleolar dominance. Trends Genet 16:
495–500.
47. Chen ZJ, Pikaard CS (1997) Transcriptional analysis of nucleolar dominance
in polyploidy plants: biased expression/silencing of progenitor rRNA genes
is developmentally regulated in Brassica. Proc Nat Acad Sci USA 94:
3442–3447.
PLoS ONE | www.plosone.org
48. López-León MD, Cabrero J, Camacho JPM (1995) Changes in DNA
methylation during development in the B chromosome NOR of the grasshopper
Eyprepocnemis plorans. Heredity 74: 296–302.
49. López-León MD, Cabrero J, Camacho JPM (1995) Changes in NOR activity in
the presence of supernumerary heterochromatin in the grasshopper Eyprepocnemis
plorans. Genome 38: 68–74.
50. Zurita S, Cabrero J, López-León MD, Camacho JPM (1998) Polymorphism
regeneration for a neutralized selfish B chromosome. Evolution 52: 274–277.
51. Manrique-Poyato MI, Muñoz-Pajares AJ, Loreto V, López-León MD,
Cabrero J, et al. (2006) Causes of B chromosome variant substitution in the
grasshopper Eyprepocnemis plorans. Chromosome Res 14: 693–700.
52. Manrique-Poyato MI (2010) Dinámica espacial y temporal de los cromosomas B
del saltamontes Eyprepocnemis plorans. PhD Universidad de Granada.
53. Camacho JPM, Perfectti F, Teruel M, López-León MD, Cabrero J (2004) The
odd-even effect in mitotically unstable B chromosomes in grasshoppers.
Cytogenet Genome Res 106: 325–331.
54. Perfectti F, Corral JM, Mesa JA, Cabrero J, Bakkali M, et al. (2004) Rapid
suppression of drive for a parasitic B chromosome. Cytogenet Genome Res 106:
338–343.
55. Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999) Common origin
of B chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity 83:
435–439.
7
75
May 2012 | Volume 7 | Issue 5 | e36600
Figure S1. Nucleotide sequence of the DNA amplified with the ITS2A and ITS2B primers.
76
1
TGGAGCCGTACGACGAAGTGGCGGCGGTTTGTGCTTGCACGACGCCGGCCGCCACACACA
61
TTTGGAACAGGGCCTGTCAAAGGGCCCAGTCCCGCCTATGCAACAGCAGGCTTTGCCTGA
121
CAAGCAAATGTATGAAAAAAGATCACCCAGGACGGTGGATCACTCGGCTCGTGGGTCGAT
181
GAAGAACGCAGCAAATTGCGCGTCGACATGTGAACTGCAGGACACATGAACATCGACGTT
241
TCGAACGCACATTGCGGTCCATGGATTCCGTTCCCGGGCCACGTCTGGCTGAGGGTCGGC
301
TACGTATACTGAAGCGCCAAGGCGTTTCGGAGACTTGGGAGCGTCGTGGTACGCCCGTCG
361
TGCCGCGTCTCCTCAAATGTGGAGTGCGCGCCCGTCGCTCGGGCGGTTCGCATACCGGTA
421
CTGTGTCTCGGTAGCGTGCACAGCTGCCCGGCGGTGCGGCGCGCTCAAACTCTTTCGTAC
481
AACG
Capítulo 3. B1 was the ancestor B
chromosome variant in the western
mediterranean area in the grasshopper
Eyprepocnemis plorans
77
78
Original Article
B1: the western-mediterranean ancestral variant
Cytogenet Genome Res
DOI: 10.1159/000356052
Accepted: June 19, 2013
by M. Schmid
Published online: November 7, 2013
B1 Was the Ancestor B Chromosome Variant in the
Western Mediterranean Area in the Grasshopper
Eyprepocnemis plorans
J. Cabrero a M.D. López-León a M. Ruíz-Estévez a R. Gómez b E. Petitpierre c
J.S. Rufas d B. Massa e M. Kamel Ben Halima f J.P.M. Camacho a
Departamento de Genética, Facultad de Ciencias, Universidad de Granada, Granada, b Departamento de
Ciencia y Tecnología Agroforestal, E.T.S. de Ingenieros Agrónomos, Universidad de Castilla La Mancha, Albacete,
c
Departament de Biologia, Laboratorio de Genetica, Universitat de les Illes Balears, Palma de Mallorca, and
d
Unidad de Biología Celular, Departamento de Biología, Facultad de Ciencias, Universidad Autónoma de Madrid,
Madrid, Spain; e Dipartimento Scienze agrarie e forestali, Palermo, Italy; f Institut Supérieur Agronomique,
Université de Sousse, Sousse, Tunisia
Key Words
B chromosome · Eyprepocnemis plorans · FISH · Ribosomal
DNA · Satellite DNA
Abstract
We analyzed the distribution of 2 repetitive DNAs, i.e. ribosomal DNA (rDNA) and a satellite DNA (satDNA), on the B chromosomes found in 17 natural populations of the grasshopper Eyprepocnemis plorans plorans sampled around the western
Mediterranean region, including the Iberian Peninsula, Balearic Islands, Sicily, and Tunisia. Based on the amount of these
repetitive DNAs, 4 types of B variants were found: B1, showing
an equal or higher amount of rDNA than satDNA, and 3 other
variants, B2, B24 and B5, bearing a higher amount of satDNA
than rDNA. The variants B1 and B2 varied in size among populations: B1 was about half the size of the X chromosome in Balearic Islands, but two-thirds of the X in Iberian populations at
Alicante, Murcia and Albacete provinces. Likewise, B2 was
about one-third the size of the X chromosome in populations
from the Granada province but half the size of the X in the
populations collected at Málaga province. The widespread
geographical distribution of the B1 variant makes it the best
candidate for being the ancestor B chromosome in the whole
western Mediterranean region.
© 2013 S. Karger AG, Basel
© 2013 S. Karger AG, Basel
1424–8581/13/0000–0000$38.00/0
E-Mail karger@karger.com
www.karger.com/cgr
B chromosomes are dispensable supernumerary elements frequently found in many eukaryote genomes in
addition to the standard (A) chromosomes. They are
mostly composed of repetitive DNAs such as ribosomal
DNA (rDNA), satellite DNA (satDNA) and mobile elements [Camacho, 2005]. The grasshopper Eyprepocnemis
plorans is an example that harbors all these components
[López-León et al., 1994; Montiel et al., 2012]. In addition
to the 22 + X0/XX standard chromosomes, more than 50
B chromosome variants have been described in the Iberian Peninsula on the basis of size and C-banding pattern
[Henriques-Gil et al., 1984; Henriques-Gil and Arana,
1990; López-León et al., 1993; Bakkali et al., 1999], all of
them being mostly made up of the same repetitive DNAs,
i.e. rDNA and a 180-bp tandem repeat satDNA, thus suggesting their common descent [Cabrero et al., 1999].
B chromosomes are frequently polymorphic with
many species showing 2 or more variants. For instance,
Hewitt [1979] called attention on 10 grasshopper species
showing more than one kind of B chromosomes, and
Jones and Rees [1982], in their seminal B chromosome
review, found more than 60 plant and animal species with
2 or more types of B chromosomes. Further cases have
been found since then, the review of which is beyond the
scope of the present study.
Juan Pedro M. Camacho
Departamento de Genética, Facultad de Ciencias
Universidad de Granada, Avda. Fuentenueva s/n
ES–18071 Granada (Spain)
E-Mail jpmcamac @ ugr.es
79
Downloaded by: J. Camacho - 59611
Fac Educacion y Humanidades
150.214.61.56 - 11/7/2013 10:02:50 AM
a
Materials and Methods
Adult males of the grasshopper E. plorans plorans were collected at Palermo (Sicily, Italy) and Chott Mariem (Sousse, Tunisia) as well as in 15 Spanish locations: S’Albufereta and S’Esgleieta
(Mallorca, Balearic Islands), San Juan (Alicante), Bullas and Cieza
(Murcia), Mundo River (Albacete), Otivar and Salobreña (Granada), Maro, Nerja, Torrox, Algarrobo, Torre del Mar, Torremolinos, and Fuengirola (Málaga province).
Testes were fixed in 3:1 ethanol:acetic acid and stored at 4 ° C until use. The number of B chromosomes in each male was determined
by squashing 2 testis follicles in 2% lacto-propionic orcein and visualizing primary spermatocytes at prophase or metaphase under an
optical microscope. This allowed selection of B-carrying males from
each population, in which we then performed 2-color fluorescent in
situ hybridization (FISH) on chromosome preparations obtained by
squashing of 2 testis follicles in 50% acetic acid. We used 2 DNA
probes, one for rDNA and the other for the 180-bp tandem repeat
satDNA, which are the 2 major constituents of B chromosomes. The
technique employed was essentially that described in Cabrero et al.
[1999]. Chromosome preparations were analyzed under a BX41
Olympus epifluorescence microscope, and photographs were captured with a DP70 cooled camera. Images were composed and optimized for brightness and contrast with the GIMP freeware.
Results and Discussion
Dual-color FISH analysis with rDNA and satDNA
probes showed that the B chromosomes found in all natural populations sampled were mostly made up of these
Cytogenet Genome Res
DOI: 10.1159/000356052
2
80
2 tandem repeat DNAs, with the exception of the small
short arm (fig. 1), in consistency with previous observations [Cabrero et al., 1999]. Comparative analysis of the
FISH pattern and relative size of the X and B chromosomes from the same cell allowed classifying B variants
into 4 types (fig. 1; table 1). The first type, B1, is characterized by the presence of similar amounts of both DNA
types (see Bs from San Juan, Bullas, Mundo and Cieza in
the Iberian Peninsula, and those from Sicily and Tunisia),
or else a slightly higher amount of rDNA (see Bs from
S’Albufereta and S’Esgleieta in the Balearic Islands). The
relative size of the B compared to that of the X chromosome also differed between Balearic and Iberian Bs, the
former being about half the size of the X chromosome
(likewise those in Tunisia), whereas the Iberian Bs, and
those from Sicily, were about two-thirds the X chromosome size. The differences between these 2 types of B1
chromosomes could simply be explained by changes in
the amount of satDNA.
The remaining B variants observed showed a higher
amount of satDNA than rDNA. The second type, B2,
shows satDNA and rDNA in about a 2:1 ratio, and its size
is about one-third that of the X chromosome in Salobreña
and Otívar (Granada province), but about half the size of
the X chromosome in Maro, Nerja, Algarrobo, Torre del
Mar and Torremolinos (Málaga province). Again, size
differences for B2 chromosomes between populations
could be explained by changes in the amount of the
satDNA, although we cannot rule out the possibility of
changes in the amount in rDNA, since the ratio between
the 2 types of repetitive DNA remains roughly stable between the 2 types of B2. The third type, B24, is about half
the size of the X chromosome and carries satDNA and
rDNA in a 3:1 ratio. It was present in Torrox and Algarrobo (Málaga) populations, and it arose from the B2 variant [Henriques-Gil and Arana, 1990; Zurita et al., 1998]
after amplification of the satDNA region. The fourth
type, B5, is about two-thirds the size of the X chromosome
and carries satDNA and rDNA in about a 2:1 ratio. It was
only found in Fuengirola (Málaga). It could have arisen
from B1 (which is the prevalent B variant in populations
surrounding Fuengirola) [Henriques-Gil and Arana,
1990] by amplification of the satDNA region. The former
inferences about the size of the B chromosomes are based
on the assumption that the size of the X does not vary
among populations, since B chromosome size estimations were relative to X chromosome size.
When B variants are placed in a map of the western
Mediterranean region (fig. 2), it is evident that B1 is present in all geographical zones analyzed (Sicily, Tunisia,
Cabrero et al.
Downloaded by: J. Camacho - 59611
Fac Educacion y Humanidades
150.214.61.56 - 11/7/2013 10:02:50 AM
On the basis of its widest distribution, Henriques-Gil et
al. [1984] and Henriques-Gil and Arana [1990] suggested
that B1 was the ancestor variant for B chromosomes in the
Iberian Peninsula, since it was found in populations from
almost the whole Mediterranean coast, excepting the
Granada and Western Málaga provinces, where it had been
replaced by B2, and Fuengirola, where it had been replaced
by B5. In addition, B2 was replaced by B24 in the Torrox
population [Zurita et al., 1998]. A comparison with B chromosomes found in eastern Mediterranean (Greece and
Turkey) and Caucasian (Armenia and Dagestan) populations showed that B chromosomes from these latter populations were mostly composed of rDNA, with much smaller
amounts of satDNA than western B chromosomes [LópezLeón et al., 2008]. However, nothing was known about populations between these 2 extremes. Here, we analyze B chromosomes from Sicily and Tunisia in addition to 15 Spanish
populations and conclude that the B1 chromosome is the
most widespread variant in the whole western Mediterranean region (including Sicily and Tunisia), which suggests
that it was probably the ancestral B variant in this region.
B1: the western-mediterranean ancestral variant
Fig. 1. Dual-color FISH patterns for the
Balearic Islands, and Iberian Peninsula). Bearing in mind
that it is also present in Moroccan populations [Cabrero
et al., 1999], we can conclude that B1 is the most widely
distributed B chromosome variant in the western Mediterranean region. In natural populations to the east of Sicily and Tunisia (e.g. Greece and Turkey), B chromosomes
are mostly composed of rDNA, with considerably smaller
amounts of satDNA than Western B chromosomes [Abdelaziz et al., 2007; López-León et al., 2008], so that, under
the criteria employed here, they are rather different B
types.
The B1 variant was considered the ancestral B chromosome type in the Iberian Peninsula because it shows the
widest geographical distribution along the Mediterranean coast, from Tarragona to Huelva [Henriques-Gil et
al., 1984; Henriques-Gil and Arana, 1990]. Our present
results suggest that B1 was the ancestral B variant for the
whole western Mediterranean region. Recent molecular
analysis of a 1,510-bp SCAR (sequence-characterized amplified region) marker specific to the B chromosomes has
shown extremely scarce variation in its DNA sequence
between Bs from both western (Spain and Morocco) and
eastern (Greece, Turkey and Armenia) Mediterranean regions, which, for a dispensable chromosome, probably
implies a very recent origin for these B chromosomes
[Muñoz-Pajares et al., 2011]. Two additional facts point
to the recent origin of B chromosomes in the Iberian Peninsula, both assuming that B chromosomes invaded the
Iberian Peninsula through coastal populations in which
B chromosomes are universally present. First, B chromosomes are absent around the headwaters of the Spanish
Segura River basin, because abrupt geographical barriers
have impeded the advance of B-carrying individuals [Cabrero et al., 1997; Manrique-Poyato et al., in preparation].
Second, the Otívar population, by the Verde River in the
Spanish Granada province, is located 10 km from the
coast and has been invaded by B chromosomes in the last
35 years [Camacho et al., submitted], whereas B invasion
had been completed prior to 1977 in 4 other populations
closer to the coast [Camacho et al., 1980]. The fact that B
B1 Was the Ancestor B Variant in
Western E. plorans
Cytogenet Genome Res
DOI: 10.1159/000356052
3
81
Downloaded by: J. Camacho - 59611
Fac Educacion y Humanidades
150.214.61.56 - 11/7/2013 10:02:50 AM
rDNA and satDNA probes found in X and
B chromosomes from 17 natural E. plorans
populations. X and B chromosomes depicted for each population are from the same
diplotene cell. Given that X and B chromosomes show positive heteropycnosis during this meiotic stage, their relative sizes
can be compared. Note that B size in respect to X size varies among populations,
the B being about half the size of the X in
S’Albufereta, S’Esgleieta, Nerja, and Algarrobo (B2), about one-third in Salobreña
and Otívar, and about two-thirds in San
Juan, Mundo, Cieza, Algarrobo (B24), Torrox, and Fuengirola populations. Note also
that the relative amount of rDNA and
satDNA varies among B types, being almost equal for the B1 types, except for a
slightly larger amount of rDNA in
S’Albufereta and S’Esgleieta. The other
variants show relatively smaller amounts of
rDNA: one-third in B2 and B5 and onefourth in B24. A = Alicante; Ab = Albacete;
Ba = Balearic Islands; Gr = Granada; Ma =
Málaga; Mu = Murcia. Scale is variable for
the different cells used, but the X chromosome in E. plorans is about 5 μm long.
Table 1. Geographical location of the 17 populations analyzed, relative size of their B chromosomes in respect to the X chromosome,
relative proportions of rDNA and satDNA in the B chromosomes, and B chromosome type
Population
Altitude, m B/X length rDNA/satDNAa
Country
Latitude
Longitude
Chott Mariem Sousse
Tunisia
35°52′44′′N
10°35′55′′E
6
1/2
rDNA = satDNA
B1
Micciulla
Palerm
Italy
38°06′20′′N
13°19′12′′E
97
2/3
4/5
rDNA = satDNA
rDNA = satDNA
B1
B1iso
S’Albufereta
Balearic Islands
Spain
39°51′41′′N
3°05′43′′E
1
1/2
rDNA > satDNA
B1
S’Esgleieta
Balearic Islands
Spain
39°39′12′′N
2°38′33′′E
103
1/2
rDNA > satDNA
B1
San Juan
Alicante
Spain
38°23′45′′N
0°25′19′′E
22
2/3
rDNA = satDNA
B1
Bullas
Murcia
Spain
38°02′30′′N
1°40′06′′W
636
2/3
rDNA = satDNA
B1
Cieza
Murcia
Spain
38°13′58′′N
1°24′58′′W
165
2/3
rDNA = satDNA
B1
Mundo
Albacete
Spain
38°28′01′′N
1°47′22′′W
436
2/3
rDNA = satDNA
B1
Salobreña
Granada
Spain
36°44′20′′N
3°35′31′′W
2
1/3
rDNA < satDNA
B2
Otívar
Granada
Spain
36°48′57′′N
3°40′59′′W
234
1/3
rDNA < satDNA
B2
Maro
Málaga
Spain
36°45′34′′N
3°50′42′′W
114
1/2
1/2
rDNA < satDNA
rDNA < satDNA
B2
B2i
Nerja
Málaga
Spain
36°44′44′′N
3°53′56′′W
6
1/2
rDNA < satDNA
B2
Torrox
Málaga
Spain
36°44′24′′N
3°57′26′′W
30
2/3
rDNA < satDNA
B24
Algarrobo
Málaga
Spain
36°44′48′′N
4°02′49′′W
5
1/2
2/3
rDNA < satDNA
rDNA < satDNA
B2
B24
Torre del Mar Málaga
Spain
36°45′15′′N
4°06′15′′W
15
1/2
rDNA < satDNA
B2
Torremolinos
Málaga
Spain
36°37′50′′N
4°30′12′′W
53
1/2
rDNA < satDNA
B2
Fuengirola
Málaga
Spain
36°31′59′′N
4°38′29′′W
3
2/3
rDNA < satDNA
B5
Type
The predominant repetitive DNA in each B chromosome is shown in bold.
Fig. 2. Map of the western Mediterranean region showing the geographical distribution of the different B chromosome types found.
Note the presence of the B1 variant in all regions analyzed here and
also in Morocco as previously shown by Cabrero et al. [1999].
Cytogenet Genome Res
DOI: 10.1159/000356052
4
82
invasion continues at current times and the recent origin
of these B chromosomes suggest the possibility that B1
spread across the western Mediterranean populations
could occur in recent historical times, presumably aided
by the increase of Mediterranean commerce, since E.
plorans is very common in most Mediterranean cultivations and can be easily transported in plants [Cabrero and
Camacho, pers. observation].
It is remarkable that most of the changes that B chromosomes have experienced in the south of the Iberian
Peninsula, giving birth to the B24 and B5 variants, have
mainly implied changes in the amount of satDNA. It has
been shown that the replacement of B2 by B24 in the Torrox population was based on significant drive for B24 but
absence of it for B2 [Zurita et al., 1998]. Cabrero et al.
[1999] thus suggested that the replacement of ancestral
Cabrero et al.
Downloaded by: J. Camacho - 59611
Fac Educacion y Humanidades
150.214.61.56 - 11/7/2013 10:02:50 AM
a
Province
B1: the western-mediterranean ancestral variant
variants (e.g. B2 by B24 or B1 by B5) could be facilitated by
a higher relative amount of satDNA in respect to rDNA.
This could be valid for western Mediterranean Bs, where
a relative increase in satDNA has been observed in the
new variants in respect to the ancestral ones. In eastern
Mediterranean Bs, however, this is less clear since Bs are
mostly made up of rDNA, with very small amounts of
satDNA, and this has not impeded their successful spreading to all regions analyzed [see López-León et al., 2008].
The appearance of new B chromosome variants in the
progeny of controlled crosses, where none of the parents
carried them, provides an estimate of the mutation rate of
B chromosomes, since it can be safely assumed that this
new variant arose by mutation of one of the Bs in the parents. Two different estimates point to the high mutability
of B chromosomes in E. plorans, with rates ranging from
0.05 to 0.21% in Spanish populations [López-León et al.,
1993] and from 0.21 to 9.6% in Moroccan populations
[Bakkali and Camacho, 2004]. This explains how a young
B chromosome system like this has given rise to so many
different B types. Only in the Iberian Peninsula, Henriques-Gil et al. [1984] characterized 14 different B variants, and López-León et al. [1993] found additional variants. Including also the variants reported by Bakkali et al.
[1999] in Morocco, Abdelaziz et al. [2007] in Greece, and
López-León et al. [2008] in Turkey, Armenia, and Dagestan, more than 50 variants have hitherto been described
in this species. Here we show a new B variant in the Maro
population (B2i) which presumably arose through a paracentric inversion changing the relative positions of the
rDNA and part of the satDNA. Inversion is a frequent
chromosome mutation affecting B chromosomes [LópezLeón et al., 1993; Bakkali and Camacho, 2004]. The high
incidence of mutations in the B chromosomes opens new
evolutionary pathways to B chromosome polymorphism
since some of the new variants can show higher transmission rates than their ancestor B and thus replace it, as
documented for B24 in the Torrox population [Zurita et
al., 1998].
Acknowledgements
We thank Karl Meunier for language revision and Camillo
Cusimano, Tommaso and Andrea La Mantia for their help in the
collection of specimens in Sicily. This study was supported by a
grant from the Spanish Ministerio de Ciencia e Innovación
(CGL2009-11917) and Plan Andaluz de Investigación (CVI-6649),
and was partially performed by FEDER funds. M.R.-E. was supported by a FPU fellowship from the Spanish Ministerio de Ciencia
e Innovación.
Abdelaziz M, Teruel M, Chobanov D, Camacho
JPM, Cabrero J: Physical mapping of rDNA
and satDNA in A and B chromosomes of the
grasshopper Eyprepocnemis plorans from a
Greek population. Cytogenet Genome Res
119:143–146 (2007).
Bakkali M, Camacho JPM: The B chromosome
polymorphism of the grasshopper Eyprepocnemis plorans in North Africa. III. Mutation
rate of B chromosomes. Heredity 92:428–433
(2004).
Bakkali M, Cabrero J, López-León MD, Perfectti
F, Camacho JPM: The B chromosome polymorphism of the grasshopper Eyprepocnemis
plorans in North Africa. I. B variants and frequency. Heredity 83:428–434 (1999).
Cabrero J, López-León MD, Gómez R, Castro AJ,
Martín-Alganza A, Camacho JPM: Geographical distribution of B chromosomes in
the grasshopper Eyprepocnemis plorans,
along a river basin, is mainly shaped by nonselective historical events. Chromosome Res
5:194–198 (1997).
Cabrero J, López-León MD, Bakkali M, Camacho
JPM: Common origin of B chromosome variants in the grasshopper Eyprepocnemis
plorans. Heredity 83:435–439 (1999).
B1 Was the Ancestor B Variant in
Western E. plorans
Camacho JPM: B chromosomes, in Gregory TR
(ed): The Evolution of the Genome, pp 223–
286 (Academic Press, New York 2005).
Camacho JPM, Carballo AR, Cabrero J: The Bchromosome system of the grasshopper Eyprepocnemis plorans subsp. plorans (Charpentier). Chromosoma 80:163–166 (1980).
Henriques-Gil N, Arana P: Origin and substitution of B chromosomes in the grasshopper Eyprepocnemis plorans. Evolution 44: 747–753
(1990).
Henriques-Gil N, Santos JL, Arana P: Evolution
of a complex polymorphism in the grasshopper Eyprepocnemis plorans. Chromosoma 89:
290–293 (1984).
Hewitt GM: Grasshopper and crickets, in John B
(ed): Animal Cytogenetics, vol. 3, Insecta 1 Orthoptera (Gebrüder Borntraeger, Berlin 1979).
Jones RN, Rees H: B Chromosomes (Academic
Press, New York 1982).
López-León MD, Cabrero J, Pardo MC, Viseras E,
Camacho JPM, Santos JL: Generating high
variability of B chromosomes in Eyprepocnemis plorans (grasshopper). Heredity 71: 352–
362 (1993).
López-León MD, Neves N, Schwarzacher T, Heslop-Harrison JS, Hewitt GM, Camacho JPM:
Possible origin of a B chromosome deduced
from its DNA composition using double
FISH technique. Chromosome Res 2: 87–92
(1994).
López-León MD, Cabrero J, Dzyubenko V, Bugrov A, Karamysheva T, et al: Differences in
ribosomal DNA distribution on A and B
chromosomes between eastern and western
populations of the grasshopper Eyprepocnemis plorans plorans. Cytogenet Genome Res
121:260–265 (2008).
Montiel EE, Cabrero J, Camacho JPM, LópezLeón MD: Gypsy, RTE and Mariner transposable elements populate Eyprepocnemis
plorans genome. Genetica 140: 365–374
(2012).
Muñoz-Pajares AJ, Martínez Rodriguez L, Teruel
M, Cabrero J, Camacho JPM, Perfectti F: A
single, recent origin of the accessory B chromosome of the grasshopper Eyprepocnemis
plorans. Genetics 187:853–863 (2011).
Zurita S, Cabrero J, López-León MD, Camacho
JPM: Polymorphism regeneration for a neutralized selfish B chromosome. Evolution 52:
274–277 (1998).
Cytogenet Genome Res
DOI: 10.1159/000356052
5
83
Downloaded by: J. Camacho - 59611
Fac Educacion y Humanidades
150.214.61.56 - 11/7/2013 10:02:50 AM
References
84
Capítulo 4. Ribosomal DNA is active in
different B chromosome variants of the
grasshopper Eyprepocnemis plorans
85
86
Genetica
DOI 10.1007/s10709-013-9733-6
rDNA transcription in B chromosome variants
Ribosomal DNA is active in different B chromosome variants
of the grasshopper Eyprepocnemis plorans
Mercedes Ruı́z-Estévez • Ma Dolores López-León
Josefa Cabrero • Juan Pedro M. Camacho
•
Received: 16 June 2013 / Accepted: 31 August 2013
Ó Springer Science+Business Media Dordrecht 2013
Abstract B chromosomes are considered to be genetically inert elements. However, some of them are able to
show nucleolus organizer region (NOR) activity, as
detected by both cytological and molecular means. The
grasshopper Eyprepocnemis plorans shows a B chromosome polymorphism characterized by the existence of
many B variants. One of them, B24, shows NOR activity in
about half of B-carrying males in the Torrox population.
Molecular data have suggested the recent origin for B
chromosomes in this species, and on this basis it would be
expected that NOR activity was widespread among the
different B variants. Here we test this hypothesis in four
different B chromosome variants (B1, B2, B5, and B24)
from 11 natural populations of the grasshopper E. plorans
covering the south and east of the Iberian Peninsula plus
the Balearic Islands. We used two different approaches: (1)
the cytological observation of nucleoli attached to the distal
region of the B chromosome (where the rDNA is located),
and (2) the molecular detection of the rDNA transcripts
carrying an adenine insertion characteristic of B chromosome ITS2 sequences. The results showed NOR expression
not only for B24 but also for the B1 and B2 variants.
However, the level of B-NOR expression in these latter
variants, measured by the proportion of cells showing
nucleoli attached to the B chromosomes, was much lower
than that previously reported for B24. This suggests the
possibility that structural or genetic background conditions
are enhancing the expressivity of the rDNA in the B24
variant.
M. Ruı́z-Estévez Ma. D. López-León J. Cabrero J. P. M. Camacho (&)
Departamento de Genética, Facultad de Ciencias, Universidad de
Granada, 18071 Granada, Spain
e-mail: jpmcamac@ugr.es
Keywords B chromosome Eyprepocnemis
plorans Nucleolus Nucleolus organizer region PCR Ribosomal DNA Transcript
Introduction
B chromosomes are dispensable supernumerary elements
appearing in about 15 % of eukaryotic genomes. They do
not recombine with standard (A) chromosomes and usually
show drive mechanisms, which provide them with transmissional advantages. They are mostly composed of
repetitive DNA of several kinds, with predominance of
ribosomal DNA (rDNA), satellite DNA (satDNA) and
mobile elements (for review, see Camacho 2005). Other
multigenes families have been reported as constituents of B
chromosomes as in the case of histones genes, present in B
chromosomes of the two grasshopper species Locusta migratoria (Teruel et al. 2010) and Rhammatocerus brasiliensis (Oliveira et al. 2011). In the ascomycetous fungus
Nectria haematococca, supernumerary chromosomes have
a lower G?C content compared to the other chromosomes
and are enriched in repeat sequences and unique and
duplicated genes (Coleman et al. 2009). In some canid
species, the presence of cancer-associated genes has been
shown, and at least one of them (the proto-oncogene cKIT)
has been shown to be transcribed and translated into
functional KIT protein (Graphodatsky et al. 2005; Yudkin
et al. 2007; Becker et al. 2011). Recent research has also
shown that rye B chromosomes are rich in gene-derived
sequences, many of them being derived from A chromosomes 3R and 7R, but they also accumulate large amounts
of specific DNA repeats and insertions of organellar DNA
(Martis et al. 2012).
123
87
Genetica
One of the repetitive DNAs most frequently harboured
by B chromosomes in many species is rDNA. It is composed of repeat units containing the genes for 18S, 5.8S
and 28S ribosomal RNAs (rRNAs), separated by two
internal transcribed spacers (ITS1 and ITS2) and flanked by
external transcribed spacers (ETS) and nontranscribed
spacers (NTS) (Long and David 1980). The chromosome
location of these genes is known as the nucleolus organizer
regions (NORs), and their phenotype, the nucleolus, is
cytologically apparent either spontaneoulsy or after using a
variety of techniques, the simplest one being silver
impregnation (Rufas et al. 1982). This technique reveals
the transcriptional machinery of the RNA polimerase I,
including the B23, nucleolin, UBF proteins and RNA pol I
subunits (Roussel et al. 1992; Roussel and HernandezVerdun 1994; Roussel et al. 1996). It has been shown that
nucleolus size is positively correlated with the rate of
rRNA synthesis (Mosgoeller 2004), indicating the recruitment of the proteins needed for rDNA transcription (Derenzini 2000).
The heterochromatic nature of most B chromosomes
appeared to suggest their genetic inertness. In fact, several
studies performed in the grasshopper Myrmeleotettix
maculatus (Fox et al. 1974), the mouse Apodemus peninsulae (Ishak et al. 1991), the black rat Rattus rattus
(Stitou et al. 2000), and the fish Metynnis maculatus
(Baroni et al. 2009) and Haplochromis obliquidens (Poletto
et al. 2010), pointed to the inactivity of B chromosome
rDNA. However, evidence of NOR activity in B chromosomes was found in some species such as the grasshopper
Dichroplus pratensis (Bidau 1986) and the mouse A. peninsulae (Boeskorov et al. 1995). At molecular level, indirect evidence of transcription from B chromosome DNA
was reported in the frog Leiopelma hochstetteri (Green
1988) and the mosquito Simulium juxtacrenobium
(Brockhouse et al. 1989). But the direct presence of rRNA
transcripts coming from a B chromosome has been reported in the plant Crepis capillaris (Leach et al. 2005), the
parasitic wasp Trichogramma kaykai (van Vugt et al. 2005)
and rye (Carchilan et al. 2009). Other B specific-repetitive
DNA sequences have been found transcriptionally active in
the B chromosome of rye (Carchilan et al. 2007).
Eyprepocnemis plorans is a grasshopper species carrying a wide variety of B chromosomes in addition to its
standard genome of 22 ? X0/XX chromosomes. More
than 50 variants have been differentiated on the basis of
size, C-banding pattern and the relative amounts of their
two main repetitive DNA components, i.e. rDNA and satDNA (López-León et al. 1993; López-León et al. 1994;
Bakkali et al. 1999; Cabrero et al. 1999). Almost all A
chromosomes in this species carry rDNA, the largest rDNA
clusters being proximally located in the chromosomes X, 9,
10 and 11, although none of these rDNA clusters is as large
123
88
as that in the B chromosome (Cabrero et al. 1999, 2003).
NOR activity is mostly found in one or more of the above
mentioned A chromosomes, and very rarely in the B
chromosomes (Cabrero et al. 1987; López-León et al.
1995). In fact, no NOR activity was found in B chromosomes of E. plorans prior to the finding of a B2 chromosome fused to the longest autosome where a nucleolus was
frequently attached to the rDNA of the B chromosome
(Cabrero et al. 1987). Remarkably, in the Torrox population (Málaga, Spain) the B24 variant recurrently showed
NOR activity in many males collected for several years
(Teruel et al. 2007, 2009). In this population, we detected
the presence of transcripts that specifically came from the
rDNA contained in the B chromosome named ITS2_B
(Ruiz-Estévez et al. 2012). This was carried out by means
of a pair of specific primers, one of them being anchored in
the 30 extreme of the ITS2 region where the B chromosome
rDNA carries an adenine insertion apparently absent in 0B
individuals (Teruel et al. submitted). Except for the fused
B2 mentioned above, nothing more is known about the
potential of B variants other than B24 to express their
rDNA. Under the hypothesis that B chromosomes in E.
plorans are young (Muñoz-Pajares et al. 2011), we predict
that most, if not all B variants should potentially conserve
the capability to express their rDNA, since there has not
been time enough for the occurrence of silencing mutations
to inactivate it. To test this hypothesis, we analyze here the
expression of the rDNA contained in four different B
chromosome variants (B1, B2, B5, y B24) from 11 natural
populations collected in the south and east of the Iberian
Peninsula and the Balearic Islands by means of cytological
and molecular approaches.
Materials and methods
Biological samples and characterization of B variants
Adult males of the grasshopper E. plorans were collected
from 11 Spanish populations. In 2010, we sampled the
Algarrobo, Nerja (Málaga province), and Salobreña (Granada) populations. In 2011, we sampled Torrox and Fuengirola (Málaga), Cieza (Murcia), San Juan (Alicante),
Mundo (Albacete), S’Albufereta and S’Esgleieta (Mallorca, Balearic Islands). In 2012, we sampled the Otı́var
population (Granada). The 2010 and 2012 samples were
analyzed by both cytological and molecular techniques,
whereas the 2011 sample was only analyzed cytologically
because of an accidental defrosting of the freezer where the
bodies were stored.
Testes were fixed in 3:1 ethanol:acetic acid for cytological studies and stored at 48 C until use. Bodies were
divided into two hemibodies, frozen in liquid nitrogen, and
rDNA transcription in B chromosome variants
Genetica
stored at -80° C for DNA and RNA isolation. Determination of B chromosome number in each male was performed by squashing two testis follicles in 2 % lactopropionic orcein and visualizing primary spermatocytes at
prophase or metaphase under an Olympus microscope. The
type of B variant was determined by the double fluorescent
in situ hybridization (FISH) technique described in Cabrero
et al. (1999).
Cytological analysis of rRNA gene expression in B
chromosomes
Testis follicle preparations of B-carrying males were silver
stained as indicated in Rufas et al. (1982) to visualize the
nucleoli attached to autosomal bivalents and X and B
chromosome univalents at diplotene cells. We stained these
preparations with 1 % Giemsa to easily differentiate
chromatin (blue-green) from nucleoli (brown). For this
purpose, we selected at least 20 diplotene cells per male,
which were photographed with an Olympus digital camera
(DP70). When the B-NOR was active, we measured the
area of the nucleolus attached to the B as well as the area of
the X chromosome as a reference to obtain a relative
measure of B-nucleoli area which could be compared
between individuals and populations with different B
chromosome variants. We measured areas with the ImageJ
and a GPL3 licensed Python program (pyFIA) (Ruiz-Ruano et al. 2011), and calculated an index of B nucleolus
area by dividing it by the X chromosome area. For this
analysis, we also measured B nucleolus area in the individuals from the Torrox population reported in Ruiz-Estévez et al. (2012). Chromosome preparations were
analysed with a BX41 Olympus epifluorescence microscope and photographs were taken with an associated DP70
cooled camera. Figures were composed and optimized for
bright and contrast with The Gimp freeware. Statistical
analysis was performed by contingency Chi square and
Student t tests with the STATISTICA 8.0 software (StatSoft, Inc. 2007).
Molecular analysis of rRNA gene expression in B
chromosomes
Genomic DNA (gDNA) and total RNA were isolated from
frozen hemibodies using ‘‘GenElute Mammalian Genomic
DNA Miniprep Kit’’ (Sigma) and ‘‘Real Total RNA Spin
Plus kit’’ (Durviz), respectively, following manufacturer’s
recommendations. RNA was submitted to an additional
20U DNase (REALSTAR kit, Durviz) post-treatment to
eliminate any gDNA contamination. Quantity and quality
(absorbance 260:280 nm = 1.9–2) of gDNA and RNA
were measured with Tecan’s Infinite 200 NanoQuant and in
a denaturing agarose gel to ensure the absence of RNA
degradation. Complementary DNA (cDNA) was obtained
with random hexamers using SuperScript III First-Strand
Shyntesis SuperMix Kit (Invitrogen). PCR amplification of
the ITS2_B sequence was performed in an Eppendorf
Mastercycler ep Gradient S (Eppendorf) using ITSA (forward) and ITSB (reverse) primers (Ruiz-Estévez et al.
2012) with gDNA, as a positive control for the presence of
the ITS2_B, and cDNA to test the presence of rRNA
transcripts carrying the ITS2_B. PCR reaction mixtures for
both gDNA and cDNA were performed in 25 ll containing
200 mM dNTPs, 10 mM each primer, 20 ng gDNA/30 ng
cDNA, 1X buffer and one unit of Taq polymerase (New
England, BioLabs). PCR conditions were the following: an
initial denaturation at 94 °C for 5 min and 30 cycles of
94 °C for 30 s, 66,4 °C (Algarrobo, Salobreña and Nerja)
or 62 °C (Otı́var) for 40 s, 72 °C for 45 s and final
extension of 72 °C for 7 min. All PCR experiments on
cDNA included a control reaction to exclude the possibility
of gDNA contamination of the original RNA samples. PCR
products were visualized in 1.5 % electrophoresis agarose
gels and the amplified fragment was cloned into the TOPO
TA vector (Invitrogen) and subsequently sequenced
(Macrogen). We analyzed the sequences with Bioedit
software version 7.1.3.0 (Hall 1999), and used BLAST
(Basic Local Alignment Search tool) at the NCBI site to
search for sequence homology with the sequences reported
by Teruel et al. (submitted) (accession numbers: JN811827
to JN811902).
Results
Silver impregnation analysis showed the sporadic expression of the rDNA contained in the B chromosome, manifested by the presence of nucleoli attached to the distal
region of the B chromosome (Fig. 1). This constituted our
cytological test for the analysis of B-NOR expression.
Table 1 shows that 202 out of the 352 males analyzed
carried B chromosomes. The cytological analysis of
B-NOR activity was performed in 156 of these males after
selecting a representative sample of B-carrying males from
each population. A total of 18 males from seven populations showed B-NOR activity, in frequencies ranging from
7.69 % in S’Esgleieta to 28.57 % in San Juan, with an
11.66 % average for the 11 populations (Table 1). Specifically, we found the presence of nucleoli attached to B
chromosomes in two males from San Juan, three from
Mundo, one from S’Esgleieta, three from Torrox, three
from Otı́var, four from Salobreña and two from Algarrobo.
In the males from Otı́var, Salobreña Nerja and Algarrobo, we also performed the molecular analysis of B-NOR
activity (Fig. 2). We obtained a PCR product for the
ITS2_B transcript (454 bp lenght) in the cDNA of five
123
89
Genetica
males: two out of the 20 males analyzed from Salobreña
(10 %), one out of the 30 males analyzed from Otı́var
(3.33 %), and two out of 13 males analyzed from Algarrobo (15.38 %), but in none of the 19 males analyzed from
Nerja. On average, 7.18 % (SE = 3.44) of the males in the
four populations provided molecular evidence for B-NOR
expression. A contingency Chi square test, comparing the
total number of males carrying the ITS2_B transcript (5)
and those lacking it (79), with the number of males
showing nucleoli attached to the B chromosomes (9) and
those lacking these nucleoli (70), in these same four populations, showed the absence of significant differences for
B-NOR activity obtained by the cytological and molecular
methods (v2 = 1.53, df = 1, P = 0.22).
Fig. 1 Diplotene cell from an Algarrobo male showing a nucleolus
attached to the B chromosome (B = B chromosome; X = X
chromosome; nu = nucleolus). Bar = 5 lm
The correspondence between cytological and molecular
data was not complete. Table 2 shows the cytological and
molecular results in the eleven males which showed
B-NOR activity by one or the other method. The ITS2_B
transcript was detected in only three out of the nine males
showing nucleoli attached to the B chromosomes, whereas
the reverse was found in the m11 male from Salobreña and
the m20 male from Algarrrobo. In order to look for possible explanations, we investigate here whether the degree
of B_NOR expression could influence its molecular
detectability. For this purpose, we quantified the proportion
of diplotene cells showing nucleoli attached to the Bs and
also the area of these nucleoli relative to the X chromosome area. We used the X chromosome as reference
instead of the B chromosome itself because the X is
expected to show much lower size variation between
populations. Table 3 shows the proportion of diplotene
cells with B-nucleoli in the nine males showing B-NOR
activity, as well as the presence of ITS2_B transcript in
their cDNA. The results show that molecular detection only
worked in three males showing B-nucleoli in 8 % or more
of their cells. The six males where molecular detection of
B-NOR activity failed showed B-nucleoli in 4–8 % of their
diplotene cells. This suggests the existence of a threshold
for molecular detection which might be about 8 % of
diplotene cells with B-nucleoli.
B-nucleolus area was measured in the same nine males,
but no clear association with molecular detection was
apparent (Table 4). Excepting male m24 from Otı́var, the
remaining males showed values close to 0.5, meaning that
the B-nucleoli had, on average, about 50 % the area of the
X chromosome. Out of the eight males fitting this pattern,
only three showed ITS2_B transcripts in their cDNA,
Table 1 Number of B-lacking and B-carrying males found in each population
Population
B-lacking
males
B-carrying
males
B variant
B-NOR
inactive
B-NOR
active
Total
% Males with
B-NOR active
S’Albufereta (Ba)
10
10
B1
10
0
10
S’Esgleieta (Ba)
12
13
B1
12
1
13
7.69
3
7
B1
5
2
7
28.57
San Juan (A)
0
Mundo (Ab)
17
19
B1
16
3
19
Cieza (Mu)
20
7
B1
7
0
7
Salobreña (Gr)
10
21
B2
14
4
18
22.22
Otı́var (Gr)
45
70
B2
Nerja (Ma)
14
21
B2
27
19
3
0
30
19
10
0
3
11
B24
13
13
B2 and B24
3
10
B5
150
202
Torrox (Ma)
Algarrobo (Ma)
Fuengirola (Ma)
Total/mean
SE
15.79
0
8
3
11
27.27
10
2
12
16.67
0
10
0
10
138
18
156
11.66
3.37
A sample of B-carrying males was analyzed by silver staining to investigate B-NOR activity inferred from the presence of nucleoli attached to B
chromosomes. SE standard error
123
90
rDNA transcription in B chromosome variants
Genetica
whereas the exceptional male did not show these transcripts despite bearing nucleoli as large as the X chromosome area. This is because its B-nucleoli appear in only
7 % of the cells.
In order to get a more general picture on these parameters, we also measured B-nucleoli area in the same diplotene cells where Ruiz-Estévez et al. (2012) reported, for
the first time at molecular level, the expression of the B
chromosome NOR in the Torrox population. Table 5
shows the proportion of cells with B-nucleoli and
B-nucleolus area measured in 14 males. The only male
failing molecular detection (m74) showed the lowest proportion of cells with B-nucleoli (10 %), and yielded the
second smallest B-nucleoli (38 % the size of the X chromosome). Another male (m45) also showed B-nucleoli in
only 10 % of diplotene cells, but it showed B-nucleoli
almost as large as the X chromosome and their ITS2_B
transcripts were molecularly detected. This might suggests
that the threshold for molecular detection of B-NOR
activity is about 10 %, with slight modifications depending
on the size of the B-nucleoli formed. However, molecular
detection was possible in m52 which showed only 5 % of
cells with B-nuceloli of size similar to that observed in
m74. Since we performed the cytological analysis of tissue
only from the testes whereas the molecular detection was
done in cDNA obtained from hemibodies (which contain a
mixture of transcripts from many tissues), this exception
observed in Torrox, and some of those mentioned above for
the other populations, could be due to differential expression of the B chromosome rDNA among tissues.
A comparison of the average values for these two
parameters between the Torrox population (Table 5) and
the three other populations (Tables 3, 4) showed that the
average area of B-nucleoli was similar in the two kinds of
population (Student t test: t = 0.46, df = 21, P = 0.65)
but, on the contrary, the proportion of cells showing
B-nucleoli was significantly higher in Torrox (t = 3.64,
df = 21, P = 0.0015). This higher expression level per
male explains the higher success of molecular detection of
B-NOR activity in Torrox (13 out of 14 males, i.e.[90 %),
in respect to the remaining populations (3 out of 9 males,
i.e. 33 %), and is consistent with the fact that B-NOR
Fig. 2 Representative results of PCR amplification of the ITS2_B
region. The gel shows the ladder, blank, positive control (C?) of the
ITS2_B (454 bp) and selected examples of B-carrying individuals
from Otı́var, Salobreña and Algarrobo showing different amplification
patterns: absence of ITS2_B transcripts (cDNA-), presence of
ITS2_B transcripts (cDNA?) and positive control for the presence of
the ITS2_B region in the genomic DNA of every B-carrying
individual (gDNA)
Table 2 Correspondence between cytological (nucleoli attached to
the Bs) and molecular (presence of ITS2_B transcripts in the cDNA)
analysis of B-NOR activity in males of the grasshopper E. plorans
Population
Male
Cytological
Molecular
Otı́var’12
m15
?
?
Otı́var’12
m24
?
-
Otı́var’12
m27
?
-
Salobreña’10
m15
?
-
Salobreña’10
m6
?
?
Salobreña’10
m11
-
?
Salobreña’10
m17
?
-
Salobreña’10
m10
?
-
Algarrobo’10
m17
?
?
Algarrobo’10
m20
-
?
Algarrobo’10
m4
?
-
Total
11
9
5
Table 3 Calculation of the
proportion of cells with active
and inactive B-NOR, based on
the presence or absence of
B-nucleoli, in the nine males
showing nucleoli attached to the
B chromosomes
The result of the molecular
detection experiment, showing
the presence of ITS2_B
transcripts, is indicated in the
last column on the right. SE
standard error
Population
Male
Cells with
B-nucleoli
Cells without
B-nucleoli
Total
Proportion of
cells with
B-nucleoli
Molecular
detection
Otı́var’12
m15
2
22
24
0.08
?
Otı́var’12
m24
2
25
27
0.07
-
Otı́var’12
m27
1
20
21
0.05
-
Salobreña’10
m15
1
25
26
0.04
-
Salobreña’10
m6
5
18
23
0.22
?
Salobreña’10
m17
2
24
26
0.08
-
Salobreña’10
m10
1
19
20
0.05
-
Algarrobo’10
m17
4
28
32
0.13
?
Algarrobo’10
m4
0.04
-
Total/mean (SE)
9
1
25
26
19
206
225
0.08 (0.02)
123
91
Genetica
Table 4 Relative B-nucleolus area in the nine males showing the presence of nucleoli attached to the B chromosomes in diplotene cells and its
correspondence with molecular detection of ITS2_B transcripts
Population
Male
Cell no.
B-nucleolus
area (a.u.)
X chrom.
area (a.u.)
Otı́var’12
m15
22
10,159
4
2,205
22
27
13,034
8,608
m24
Salobreña’10
Total/mean (SE)
Mean relative
B-nucleolus area
Molecular
detection
26,305
0.39
0.51
?
3,569
0.62
10,219
9,226
1.18
0.93
1.11
-
m27
1
1,754
5,408
0.32
0.32
m15
11
10,588
18,253
0.58
0.58
-
m6
18
1,246
6,335
0.2
0.43
?
0.59
-
1
5,049
7,975
0.63
20
2,441
5,313
0.46
22
7,081
14,284
0.5
7
3,696
10,073
0.37
21
2,268
10,817
0.21
7
7,199
7,465
0.96
m10
8
8,433
27,573
0.31
0.31
-
m17
10
4,510
15,752
0.29
0.45
?
1
5,413
11,268
0.48
23
1,835
7,007
0.26
m4
28
22
2,014
5,694
2,602
9,860
0.77
0.58
0.58
-
9
19
m17
Algarrobo’10
Relative B-nucleolus
area
0.54 (0.06)
SE standard error; a.u. arbitrary units
Table 5 Proportion of cells showing B-nucleoli and relative area of
the B-nucleolus in respect to the X chromosome area in the same cell
in 14 males from the Torrox population collected in 2008 and
reported by Ruiz-Estévez et al. (2012)
Male
Proportion of
cells with
B-nucleoli
Relative
B-nucleolus
area
Molecular
detection
m54
0.50
0.53
?
m49
0.30
0.40
?
m58
0.20
0.42
?
m67
0.25
0.34
?
m52
m45
0.05
0.10
0.41
0.96
?
?
m74
0.10
0.38
-
m61
0.30
0.40
?
m63
0.25
0.68
?
m55
0.40
0.42
?
m62
0.38
0.58
?
m50
0.35
0.57
?
m42
0.15
0.54
?
m71
0.20
0.43
?
Mean (SE)
0.25 (0.04)
0.50 (0.04)
Molecular detection of ITS2_B transcripts in these males. SE standard
error
123
92
expression was observed in 48 % of B-carrying males from
Torrox (Ruiz-Estévez et al. 2012) but only in about 10 %
of those analyzed here from the other populations (calculated from Table 1, excluding the Torrox males).
Discussion
Our present results have shown that the expression of the
rDNA contained in the B chromosomes of the grasshopper
E. plorans, which had been previously detected in the
Torrox population for the B24 variant (Teruel et al. 2007,
2009; Ruiz-Estévez et al. 2012), also takes place in other
populations and B variants. The populations where B-NOR
activity was detected belong to a broad range of Spanish
regions including the South (Torrox, Otı́var, Salobreña and
Algarrobo) and the East (Mundo and San Juan) of the
Iberian Peninsula, as well as Balearic Islands (S’Esgleieta).
It is remarkable that no B-NOR activity was detected in
any of the 19 B-carrying males analyzed from Nerja, even
though this population is located at only eight Km east of
Torrox. However, it was observed in Algarrobo at about
10 km west of Torrox. The different B variants (B2 in
Nerja and B24 in Torrox) analyzed in both populations
Genetica
might account for the different level of B-NOR expression
observed. However, B-NOR expression for B2 has been
observed in the nearby population of Algarrobo and in the
two eastern populations of Salobreña and Otı́var.
The frequency of males expressing the B-NOR varied
among the populations analyzed here (0–28.57 %) (see
Table 1), although the differences did not reach significance (v2 = 13.57, df = 10, P = 0.19). Remarkably, all
these frequences were lower than that observed in Torrox
in 2008 (48 %) (Ruiz-Estévez et al. 2012). This suggests
that B chromosomes in other populations than Torrox are
mostly silenced, with only sporadic rDNA activity. The
ultimate reasons for B-NOR activity still remain obscure,
but rDNA methylation (López-León et al. 1991) and/or H3
acethylation in the B chromosome (Cabrero et al. 2007) are
probably involved.
Remarkably, NOR activity has hitherto been detected in
three of the main B chromosome variants studied in the
present work, i.e. B1 (Mundo, San Juan, and S’Esgleieta),
B2 (Algarrobo, Otı́var and Salobreña) and B24 (Torrox), but
not in B5 (Fuengirola). B chromosomes in E. plorans
appear to be of recent origin (Muñoz-Pajares et al. 2011),
and the widespread geographical distribution of B-NOR
expression on several B variants suggests that this functional feature of these B chromosomes is an ancestral
condition. Most B chromosome variants also share their
molecular composition, being mostly made of two repetitive DNAs, i.e. rDNA and a 180 bp tandem repeat DNA,
on which basis Cabrero et al. (1999) suggested the common
origin of all these B variants. The most widespread B
chromosome variant in the Iberian Peninsula is B1, for
which reason it is considered the ancestral B variant
(Henriques-Gil et al. 1984). The fact that this B variant
expresses the NOR in both the Iberian Peninsula (Mundo
population) and Balearic Islands (S’Esgleieta population)
is consistent with the ancestral condition of both the B1
variant and the B-NOR expression.
The B24 variant emerged a few decades ago in Torrox, a
population surrounded by populations where the most
frequent B chromosome was B2 and were devoid of B24
(Henriques-Gil and Arana 1990). B24 replaced B2 in this
population (Zurita et al. 1998) and has recently spread
towards the west (Algarrobo population) (Manrique-Poyato
et al. 2006) and also towards the east (Nerja population)
(Manrique-Poyato et al. submitted). The increase in
B-NOR expression observed in the B24 chromosome of
Torrox (and not in the other B variants) could thus be a
consequence of the molecular changes underwent by B2 in
Torrox to become into B24. The structural difference
between B2 and B24 is mainly due to changes in the relative
amount of the two main repetitive DNAs making up these
B chromosomes, with amplification of the 180 bp tandem
repeat DNA and deletion of part of the rDNA. Change in
rDNA transcription in B chromosome variants
rDNA amount could be a good candidate to trigger the
higher B-NOR activity in B24. Accordingly, higher transcription rates have been observed in yeast for low copy
ribosomal DNA strains comparing with high copy strains
(Ide et al. 2010). However, other structural changes could
increase B-NOR activity, as previously shown for a centric
fusion between the B2 chromosome and the longest autosome in the Salobreña population (Cabrero et al. 1987). In
this last case, the centric fusion involved the loss of the
minute small arm of the B chromosome, and this could
imply the activation of the B-NOR. However, B24 has a
short arm similar to that shown by B2, suggesting different
causes in both cases.
Another factor presumably influencing the activity of
rRNA genes on different B variants is the level of occupancy of the B-NOR by transposable elements with specific
site insertion in ribosomal RNA genes, which might inhibit
or hinder the transcription of B-rRNA genes. Indeed, the
28S rRNA genes show higher occupancy for the non-LTR
retrotransposon R2 in B24 than B2 (Montiel et al. in preparation). However, R2 ability to limit rDNA expression
depends jointly on its copy number and its distribution
within the NOR since R2-free large rDNA blocks are
preferentially expressed (Eickbush et al. 2008; Zhou and
Eickbush 2009). The higher NOR activity for B24 might
thus be due to a higher clustering of R2 copies in this
variant than in others. Alternatively, this could be a secondary effect of R2 strategy for expression on the basis of
the increase in copy numbers from B2 to B24 (Montiel et al.
in preparation). The presence in E. plorans B-NORs of
other transposable elements specifically targeting rDNA,
such as R1 retrotransposons or pokey DNA transposon,
(Eickbush 2002; Penton et al. 2002) could also influence
B-NOR expression.
The molecular detection of the ITS2_B transcripts logically depends on the degree of the B-NOR expression. At
cytological level, this dependence is mainly manifested by
the proportion of diplotene cells showing nucleoli associated to the distal region of the B (where the rDNA is
located). In fact, molecular detection of the ITS2_B transcript is unlikely under a threshold of about 10 % diplotene
cells with B-nucleoli (see Table 3). However, the likelihood of molecular detection of B-NOR activity appears to
be independent of the size of the B-nucleoli (see Table 4).
This is because most B-nucleoli have an area about half the
size of the X chromosome, and this area is independent of
the number of cells displaying nucleoli.
The existence of males where B-NOR activity was
detected cytologically but not molecularly, and vice versa,
might be explained by the fact that we performed cytological detection on spermatocytes but molecular detection
in hemibodies including a random representation of many
different tissues, and suggests the possibility that B-NOR
123
93
Genetica
expression varies between different tissues within a same
individual. This is an interesting question to explore in
future research.
The existence of a residual level of rRNA gene
expression in the B chromosomes from most E. plorans
populations indicates that some of the rRNA transcripts in
B-carrying males are B-derived. The possible biological
role of the B-derived transcripts will logically depend on
both their functionality and their abundance. We unknow
whether they are fully functional, but the low frequency of
males showing them, in most populations, suggests that
these parasitic B chromosomes are mostly repressed.
Acknowledgments We thank FJ Ruı́z-Ruano and T. López for
technical assistance, and Karl Meunier for language revision. This
study was supported by a grant from the Spanish Ministerio de
Ciencia e Innovación (CGL2009-11917) and Plan Andaluz de Investigación (CVI-6649), and was partially performed by FEDER
funds. M Ruı́z-Estévez was supported by a FPU fellowship from the
Spanish Ministerio de Ciencia e Innovación.
References
Bakkali M, Cabrero J, López-León MD, Perfectti F, Camacho JPM
(1999) The B chromosome polymorphism of the grasshopper
Eyprepocnemis plorans in North Africa I. B variants and
frequency. Heredity 83:428–434
Baroni S, Lopes CE, de Almeida-Toledo LF (2009) Cytogenetic
characterization of Metynnis maculatus (Teleostei: Characiformes): the description in Serrasalminae of a small B chromosome
bearing inactive NOR-like sequences. Caryologia 62:95–101
Becker SED, Thomas R, Trifonov VA, Wayne RK, Graphodatsky AS,
Breen M (2011) Anchoring the dog to its relatives reveals new
evolutionary breakpoints across 11 species of the Canidae and
provides new clues for the role of B chromosomes. Chromosome
Res 19:685–708
Bidau CJ (1986) A nucleolar-organizing B chromosome showing
segregation-distortion in the grasshopper Dichroplus pratensis
(Melanoplinae, Acrididae). Can J Genet Cytol 28:138–148
Boeskorov GG, Kartavtseva IV, Zagorodniuk IV, Belianin AN,
Liapunova EA (1995) Nucleolus organizer regions and B-chromosomes of field mice (Mammalia, Rodentia, Apodemus).
Genetika 31(2):185–192
Brockhouse C, Bas JAB, Fereday RM, Strauss NA (1989) Supernumerary chromosomes evolution in the Simulium vernum group
(Diptera: Simulidae). Genome 32:516–521
Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the grasshopper Eyprepocnemis plorans on nucleolar
organizer regions activity. Activation of a latent NOR on a B
chromosome fused to an autosome. Genome 29:116–121
Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999)
Common origin of B chromosome variants in the grasshopper
Eyprepocnemis plorans. Heredity 83:435–439
Cabrero J, Bugrov A, Warchałowska-Sliwa E, López-León MD,
Perfectti F, Camacho JPM (2003) Comparative FISH analysis in
five species of Eyprepocnemidine grasshoppers. Heredity
90:377–381
Cabrero J, Teruel M, Carmona FD, Jiménez R, Camacho JPM (2007)
Histone H3 lysine 9 acetylation pattern suggests that X and B
chromosomes are silenced during entire male meiosis in a
grasshopper. Cytogenet Genome Res 119:135–142
123
94
Camacho JPM (2005) B chromosomes. In: Gregory TR (ed) The
evolution of the genome. Academic Press, New York,
pp 223–286
Carchilan M, Delgado M, Ribeiro T, Costa-Nunes P, Caperta A et al
(2007) Transcriptionally active heterochromatin in rye B chromosomes. Plant Cell 19:1738–1749
Carchilan M, Kumke K, Mikolajewski S, Houben A (2009) Rye B
chromosomes are weakly transcribed and might alter the
transcriptional activity of A chromosome sequences. Chromosoma 118:607–616
Coleman JJ, Rounsley SD, Rodriguez-Carres M, Kuo A, Wasmann
CC et al (2009) The genome of Nectria haematococca:
contribution of supernumerary chromosomes to gene expansion.
PLoS Genet 5(8):e1000618. doi:10.1371/journal.pgen.1000618
Derenzini M (2000) The AgNORs. Micron 31:117–120
Eickbush TH (2002) R2 and related site-specific non-long terminal
repeat retrotransposons. In: Craig NL, Craigie R, Gellert M,
Lambowitz AM (eds) Mobile DNA II. ASM Press, Washington,
DC, pp 813–835
Eickbush DG, Ye J, Zhang X, Burke WD, Eickbush TH (2008)
Epigenetic regulation of retrotransposons within the nucleolus of
Drosophila. Mol Cell Biol 28:6452–6461
Fox DP, Hewitt GM, Hall DJ (1974) DNA replication and RNA
transcription of euchromatic and heterocromatic chromosome
regions during grasshopper meiosis. Chromosoma 45:43–62
Graphodatsky AS, Kukekova AV, Yudkin DV et al (2005) The protooncogene C-KIT maps to canid B-chromosomes. Chromosome
Res 13:113–122
Green DM (1988) Cytogenetics of the endemic New Zeland frog,
Leiopelma hochstetteri: extraordinary supernumerary chromosome variation and a unique sex-chromosome system. Chromosoma 97:55–70
Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl
Acids Symp Ser 41:95–98
Henriques-Gil N, Arana (1990) Origin and substitution of B
chromosomes in the grasshopper Eyprepocnemis plorans. Evolution 44:747–753
Henriques-Gil N, Santos JL, Arana P (1984) Evolution of a complex
polimorphism in the grasshopper Eyprepocnemis plorans. Chromosoma 89:290–293
Ide S, Miyazzaki T, Maki H, Kobayashi T (2010) Abundance of
ribosomal RNA gene copies maintains genome integrity. Science
327:693–696
Ishak B, Jaafar H, Maetz JL, Rumpler Y (1991) Absence of
transcriptional activity of the B-chromosome of Apodemus
peninsulae during pachytene. Chromosoma 100:278–281
Leach CR, Houben A, Bruce F, Pistrick K, Demidov D et al (2005)
Molecular evidence for transcription of genes on a B chromosome in Crepis capillaris. Genetics 171:269–278
Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev
Biochem 49:727–764
López-León MD, Cabrero J, Camacho JPM (1991) A nucleolus
organizer region in a B chromosome inactivated by DNA
methylation. Chromosoma 100:134–138
López-León MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM,
Santos JL (1993) Generating high variability of B chromosomes
in Eyprepocnemis plorans (grasshopper). Heredity 71:352–362
López-León MD, Neves N, Schwarzacher T, Heslop-Harrison JS,
Hewitt GM et al (1994) Possible origin of a B chromosome
deduced from its DNA composition using double FISH technique. Chromosome Res 2:87–92
López-León MD, Cabrero J, Camacho JPM (1995) Changes in NOR
activity in the presence of supernumerary heterochromatin in the
grasshopper Eyprepocnemis plorans. Genome 38:68–74
Genetica
Manrique-Poyato MI, Muñoz-Pajares AJ, Loreto V, López-León MD,
Cabrero J et al (2006) Causes of B chromosome variant
substitution in the grasshopper Eyprepocnemis plorans. Chromosome Res 14:693–700
Martis MM, Klemme S, Ali Mohammad Banaei-Moghaddam AM
et al (2012) Selfish supernumerary chromosome reveals its origin
as a mosaic of host genome and organellar sequences. Proc Natl
Acad Sci USA 109(33):13343–13346
Mosgoeller W (2004) Nucleolar ultrastructure in vertebrates. In:
Olson MOJ (ed) The Nucleolus. Kluwer, New York, pp 10–20
Muñoz-Pajares AJ, Martı́nez-Rodrı́guez L, Teruel M et al (2011) A
single, recent origin of the accessory B chromosome of the
grasshopper Eyprepocnemis plorans. Genetics 187:853–863
Oliveira NL, Cabral-de-Mello RochaMF, Loreto V, Martin C, Moura
RC (2011) Chromosomal mapping of rDNAs and H3 histone
sequences in the grasshopper Rhammatocerus brasiliensis
(acrididae, gomphocerinae): extensive chromosomal dispersion
and co-localization of 5S rDNA/H3 histone clusters in the A
complement. Mol Cytogenet 4:24
Penton EH, Sullender BW, Crease TJ (2002) Pokey, a new DNA
transposon in Daphnia (Cladocera: Crustacea). J Mol Evol
55(6):664–673
Poletto AB, Ferreira IA, Martins C (2010) The B chromosomes of the
African cichlid fish Haplochromis obliquidens harbour 18S
rRNA gene copies. BMC Genet 11:1
Roussel P, Hernandez-Verdun D (1994) Identification of Ag-NOR
proteins, markers of proliferation related to ribosomal gene
activity. Exp Cell Res 214:465–472
Roussel P, Belenguer P, Amalric F, Hernandez-Verdun D (1992)
Nucleolin is an Ag-NOR protein; this property is determined by
its amino-terminal domain independently of its phosphorylation
state. Exp Cell Res 203:259–269
Roussel P, Andre C, Comai L, Hernandez-Verdun D (1996) The
rDNA transcription machinery is assembled during mitosis in
active NORs and absent in inactive NORs. J Cell Biol
133:235–246
Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver
staining procedure for the localization of nucleolus and nucleolar
organizer under light and electron microscopy. Arch Biol
93:267–274
rDNA transcription in B chromosome variants
Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012)
B-Chromosome Ribosomal DNA is functional in the grasshopper Eyprepocnemis plorans. PLoS ONE 7(5):e36600. doi:10.
1371/journal.pone.0036600
Ruiz-Ruano FJ, Ruiz-Estévez M, Rodrı́guez-Pérez J, López Pino JL,
Cabrero J, Camacho JPM (2011) DNA amount of X and B
chromosomes in the grasshoppers Eyprepocnemis plorans and Locusta migratoria. Cytogenet Genome Res
134:120–126
StatSoft, Inc. (2007) STATISTICA (data analysis software system),
version 8.0. www.statsoft.com
Stitou S, Dı́az de la Guardia R, Jiménez R, Burgos M (2000) Inactive
ribosomal cistrons are spread throughout the B chromosomes of
Rattus rattus (Rodentia, Muridae). Implications for their origin
and evolution. Chromosome Res 8(4):305–311
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size
variation during meiosis and NOR activity of a B chromosome in
the grasshopper Eyprepocnemis plorans. Chromosome Res
15:755–765
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative
analysis of NOR expression in a B chromosome of the
grasshopper Eyprepocnemis plorans. Chromosoma 118:291–301
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromosome ancestry revealed by histone genes in the migratory locust.
Chromosoma 119:217–225
van Vugt JJFA, de Nooijer S, Stouthamer R, de Jong H (2005) NOR
activity and repeat sequences of the paternal sex ratio chromosome of the parasitoid wasp Trichogramma kaykai. Chromosoma
114:410–419
Yudkin DV, Trifonov VA, Kukekova AV et al (2007) Mapping of
KIT adjacent sequences on canid autosomes and B chromosomes. Cytogenet Genome Res 116:100–103
Zhou J, Eickbush TH (2009) The pattern of R2 retrotransposon
activity in natural population of Drosophila simulans reflects the
dynamic nature of rDNA locus. PLoS Genet 5:e1000386
Zurita S, Cabrero J, López-León MD, Camacho JPM (1998)
Polymorphism regeneration for a neutralized selfish B chromosome. Evolution 52:274–277
123
95
96
Capítulo 5. B chromosomes in
Eyprepocnemis plorans are present in all
body parts analyzed and show extensive
variation for rDNA copy number
97
98
B chromosomes in Eyprepocnemis plorans are present in all body parts
analyzed and show extensive variation for rDNA copy number
Mercedes Ruíz-Estévez, Mª Dolores López-León, Josefa Cabrero Hurtado, Juan Pedro
M Camacho*
Departamento de Genética, Facultad de Ciencias, Universidad de Granada, 18071
Granada, Spain
Short title: Mitotic stability of B chromosomes
Key words: B chromosomes, FISH, mitotic stability, qPCR, rDNA
99
Abstract
B chromosomes in the grasshopper Eyprepocnemis plorans are considered to be
mitotically stable because all cells analyzed in meiotic (primary spermatocytes and
oocytes) or mitotic (embryos, ovarioles and gastric caecum) cells within a same
individual show the same number of them. Nothing is known, however, the body parts
containing somatic tissues with no mitotic activity in adult individuals, which constitute
the immense majority of their body. The development of two B-specific molecular
markers has provided the opportunity to test for B chromosome presence in any body
part, even those lacking cell division activity. Therefore, we focused on two main
objectives: i) ascertaining whether B chromosomes are present in 8 different somatic
body parts from both sexes (head, cerebral ganglion, antennae, wing muscles, hind legs,
gastric caecum, Malphigian tubules and male accessory gland) as well as ovarioles in
females and testes in males, by means of PCR analysis, and ii) elucidating the number
of B chromosomes that an individual carries through quantifying its B-rDNA copy
number by qPCR. Our results indicated the amplification of both B-specific markers in
all analyzed body parts from B-carrying males, but not in those from B-lacking males.
However, we failed in our second objective due to high variation found between males
for the estimated number of rDNA units present in the B chromosomes. These results
demonstrate the presence of B chromosomes in all body parts of individuals and
suggest the occurrence of high variation in the rDNA content of the B chromosomes
carried by different individuals from a same population, presumably due to unequal
crossovers during meiosis.
Introduction
Supernumerary (B) chromosomes are dispensable extra chromosomes representing
specific kind of selfish genetic elements, appearing in about 15% of eukaryotic
genomes. They do not recombine with the standard (A) genome, are rich in repetitive
DNA such as satellite DNA, ribosomal DNA (rDNA) and mobile elements, and show
drive mechanisms guaranteeing their maintenance in natural populations (for review,
see Camacho 2005). Since mitotical instability constitutes the drive mechanism in many
B chromosome systems, the number of B chromosomes in the germ line becomes
higher than that in the somatic line (for review, see Jones, 1995), a thorough knowledge
of mitotic stability of B chromosomes is necessary in order to understand their
biological role. Of course, a decay of B chromosome numbers in somatic tissues could
actually make them less harmful for the host genome. In fact, the presence of higher B
frequency in the germ line than in the somatic line constitutes a common drive
mechanism for B chromosomes in both plants (e.g. Crepis capillaris, see Rutishauser
and Röthlisberger, 1966) and animals (e.g. Locusta migratoria, see Kayano, 1971). In
extreme cases, B chromosomes are apparently restricted to the germ line, as is the case
100
Mitotic stability of B chromosomes
of the plants Aegilops mutica (Mochizuki, 1957; Ohta, 1986) and A. speltoides
(Mendelson and Zohari, 1972) where Bs are absent from roots but present in flowers.
The classical cytological analysis depends on the availability of tissues showing
mitotic (or meiotic) activity. In grasshoppers, B chromosome presence has traditionally
been analyzed in testes, ovarioles and gastric caecum, in adult as well as embryos. This
has shown that B chromosomes are mitotically stable (and thus show the same number
in all cells analyzed from a same individual) in Myrmeleotettix maculatus (John and
Hewitt 1965), Phaulacridium vittatum (Jackson and Cheung, 1967), Eyprepocnemis
plorans (Camacho et al., 1980) and Dichroplus pratensis (Bidau et al., 2004), but
mitotically unstable (thus showing different B numbers among cells within a same
individual) in Locusta migratoria (Nur, 1969; Kayano, 1971; Pardo et al., 1995),
Camnula pellucida (Nur 1969), and Dichroplus elongatus (Remis et al., 2004). In no
case it is known whether B chromosomes are eliminated from some somatic body parts.
In one of the species showing mitotically stable B chromosomes, E. plorans, we
have recently developed two molecular markers specific to B chromosomes, which
represent an opportunity to test for B presence in all kinds of somatic body parts
through PCR tests. These were a SCAR marker constituting part of the external spacer
of the 45S rDNA (Muñoz-Pajares et al., 2011), and an adenine insertion in the ITS2
region of the rDNA from the B chromosomes (ITS2_B marker) (Teruel, 2009; RuizEstévez et al., 2012; Teruel et al., submitted). These molecular markers have allowed us
to test the two following hypotheses: 1) Are B chromosomes present in all body parts?
2) Is B chromosome composition similar in all males from a same population, so that
the number of rDNA units in an individual could serve to infer the number of Bs it
carries? In this work, we test both hypotheses by analyzing, with these molecular
markers, the presence of B chromosomes in 10 different body parts, and estimating the
number of rDNA units in individuals from two natural populations carrying different B
variants.
Materials and methods
Biological material preparation
We collected 41 males and 7 females of E.plorans in Torrox (Málaga, Spain), and 12
males in Salobreña (Granada, Spain). They were anesthetized and dissected under
binocular microscope to take out a portion of the gonads, which was fixed in 3:1
ethanol-acetic acid (ovarioles were pretreated with 0,075% colchicine for 2h prior to
fixation) and stored at 4ºC. We froze in liquid nitrogen the whole bodies of 28 males
from Torrox and all of those from Salobreña, which were used in B-rDNA copy number
estimation. The remaining individuals were used in both B-rDNA copy number and B
presence analyses in different body parts, for which we froze them in different parts
(antenna, cerebral ganglia, head, hind leg, wing muscle, gonad, Malpighian tubules,
101
gastric caeca and male accessory gland) in liquid nitrogen, and stored at -80ºC. The
number of B chromosomes of each male was determined by squashing two testis
follicles in 2% lacto-propionic orcein. In females, we performed C-Banding on squash
preparations of two ovarioles in 50% acetic acid (Camacho and Cabrero, 1983).
Genomic DNA (gDNA) was extracted from every tissue by using the “GenElute
Mammalian Genomic DNA Miniprep Kit” (Sigma) following manufacturer’s
recommendations, and DNA quality and quantity was measured with Tecan'sInfinite
200 NanoQuant.
B presence in the body parts
B chromosome presence was assessed in all body parts by PCR analysis of the SCAR
and ITS2_B markers, whose PCR products have 1510 bp and 484 bp, respectively,
following the protocols described in Muñoz-Pajares et al. (2011) and Ruiz-Estévez et al.
(2012). PCR products were visualized by electrophoresis in 1.5% agarose gels, the
amplified fragments were cloned into TOPO TA vector (Invitrogen) and subsequently
sequenced (Macrogen) to confirm sequence identity. We analyzed DNA sequences with
Bioedit software version 7.1.3.0 (Hall, 1999), and used BLAST (Basic Local Alignment
Search tool) at the NCBI site to search for sequence homology with the sequences
reported by Muñoz-Pajares et al. (2011) (accession number: FR681612) and Teruel et
al. (submitted) (accession numbers: JN811827-JN811902).
B-rDNA copy number estimation at the individual and body part levels
On the basis of the ITS2_B marker sequence, we designed a new F primer anchored
closer to the R one, in order to obtain a smaller PCR product appropriate for qPCR (we
named qITS2_B this shorter marker). To estimate rDNA copy number in the B
chromosome, we performed quantitative PCR (qPCR) on genomic DNA (gDNA) from
every individual and the results were analysed by means of the “Linear Regression
PCR” software (LingRegPCR; Feng et al., 2008). We previously compared this method
with the “Linear Regression of Efficiency” method (LRE; Rutledge et al., 2008), which
uses lambda gDNA as Calibrator Factor, and observed that LinRegPCR showed higher
reproducibility in most of the replicate runs, and had three advantages: 1) the
Calibration Factor carries your target sequence, 2) the software performs specific
quality checks in every single amplification curve, and 3) it gives a statistically analyzed
mean amplification efficiency value (Sommeregger et al., 2013). Reaction mixtures
contained 5µl 2X SensiMixTM SYBR Mastermix (SensiMixTM SYBR Kit, Bioline),
0.7µM each forward (ITSD: 5’ ACTTGGGAGCGTCGTGGTA 3’) and reverse primer
(ITSA: 5’ CGTTGTACGAAAGAGTTTGAG 3’) and 25ng gDNA, in a final volume of
15µl. Reactions were made in triplicate and, in each run, we included a negative control
without gDNA to ensure that the reagents were free of contaminating DNA. qPCR
102
Mitotic stability of B chromosomes
program consisted of an initial denaturation at 95ºC for 10 min, 40 cycles of 94ºC for 30
s, 63ºC for 15 s, 72ºC for 15 s, and a final dissociation step to identify the unique and
specific amplification of the target sequence. The program was run in a Chromo4
(BioRad) thermal cycler and the Opticon Monitor v3.1 software was used to export the
raw data.
Fluorescent in situ hibridization (FISH)
We performed FISH on chromosome preparations obtained by squashing of two testis
follicles in 50% acetic acid, using a 1113 bp DNA probe from E.plorans 18S ribosomal
DNA (rDNA). This fragment was obtained using the 18S-E and 1100R primers
designed by Timothy et al (2000) with the following PCR conditions: an initial
denaturation at 94ºC for 3 min and 30 cycles of 94ºC for 30 s, 45ºC for 1 min, 72ºC for
2 min, and final extension of 72ºC for 7 min. Probe labeling and FISH protocol
employed was essentially that described in Cabrero et al. (1999). rDNA array size was
analysed under the BX41 Olympus epifluorescence microscope and photographs were
captured with a DP70 cooled camera. Images were composed and optimized for bright
and contrast with The Gimp freeware.
Statistical analyses
For statistical analysis, we first tested whether the variables assayed fitted a normal
distribution with the Kolmogorov-Smirnov test and, when necessary, they were log
transformed. Parametric analyses were then performed: Student t-test, one-way
ANOVA and mixed-model ANOVA were performed with the Statistica 6.0 software
(Statsoft Inc.).
Results
Analysis of B chromosome presence
The cytological analysis in the gonads of the individuals collected for the study of B
chromosome presence in different body parts showed that two females and seven males
lacked B chromosomes, whereas five females and six males carried them. After PCR
analysis, the two molecular markers of B chromosome presence (SCAR and ITS2_B)
showed amplification in all body parts analyzed (antenna, cerebral ganglia, head, hind
leg, wing muscle, testes, ovaries, Malpighian tubules, gastric caecum and male
accessory gland) on gDNA from B-carrying individuals, but not from B-lacking
individuals (Fig. 1).
103
Fig. 1 Agarose electrophoresis gels showing the presence of the 1510 bp SCAR (a) and
the 484 bp ITS2_B fragments (b) after PCR amplification in the gDNA from the
different body parts in representative B-carrying males (m1 +B and m2 +B in a) and
females (f1 +B and f2 +B in b), and its absence in a B-lacking male (m3 0B in a) and
female (f3 0B in b) (he: head; ga: ganglion; an: antenna; Mt: Malphigian tubules; cae:
gastric caeca; tes: testis; le: hind leg; ag: accessory gland; ov: ovariole; wm: wing
muscles).
B-rDNA copy number estimation in male bodies
The estimation of rDNA copy number (qITS2_B) for the B24 chromosome was
performed on 28 males from the Torrox population, 5 of which lacked B chromosomes
and the remaining 23 carrying them (8 with 1B, 8 with 2B and 7 with 3B) (Table 1).
Surprisingly, there were 142 qITS2_B copies on average in B-lacking males, suggesting
the presence of a few copies in the standard A chromosomes. In the B-carrying males,
however, the number of qITS2_B copies was much higher,ranging from 557 (in a 2B
male) to 6434 (in a 3B male). This high variation was observed even between males
carrying the same number of B chromosomes (see Table 1). The number of qITS2_B
copies per B chromosome was calculated by subtracting the 142 copies observed in 0B
males and then dividing the remaining copies between the number of B chromosomes in
the same male. The estimated number of copies per B chromosome thus ranged from
208 to 3970, and there were not significant differences between 1B (mean= 1778, N= 8,
SD= 1311), 2B (mean= 1354, N= 8, SD= 683) and 3B males (mean= 1352, N= 7, SD=
638) for this parameter (One-way ANOVA: F= 0.53, df= 2, 20, P= 0.60). The average
copy number in the 23 B-carrying males was 1501 (SD= 921).
104
Mitotic stability of B chromosomes
Table 1 Number of qITS2_B copies per genome in different
males from Torrox and number of copies corresponding to
one B 24 in each male. The numbers in red correspond to the
males where the FISH was also performed.
Id
Bs
qITS2_B
TII'08 m70
TII'08 m53
TII'12 m8
TII'12 m12
TII'12 m32
Mean
TII'08 m49
TII'12 m1
TII'12 m3
TII'12 m5
TII'08 m66
T0'12 m2
TII'08 m69
TII'08 m24
TII'12 m2
T03 m8
TII'12 m14
TII'12 m13
TII'08 m63
TII'08 m55
TII'12 m11
TII'12 m9
T04 m110
TII'08 m62
T0'12 m1
TII'08 m50
TII'08 m42
TII'08 m71
T'04 m105
0
0
0
0
0
165
178
98
114
153
142
567
934
966
969
1881
2513
3420
4112
557
1613
1912
2720
3837
3866
4078
4217
1540
2343
3534
3732
5780
6020
6434
1
1
1
1
1
1
1
1
2
2
2
2
2
2
2
2
3
3
3
3
3
3
3
Discounting
0B copies
qITS2_B
per B
chromosome
425
792
824
827
1739
2371
3278
3970
415
1471
1770
2578
3695
3724
3936
4075
1398
2201
3392
3590
5638
5878
6292
425
792
824
827
1739
2371
3278
3970
208
736
885
1289
1848
1862
1968
2038
466
734
1131
1197
1879
1959
2097
We also estimated the number of qITS2_B copies for the B 2 chromosome in 12 males
from the Salobreña population (3 with 0B, 5 with 1B and 4 with 2B). B2 chromosomes
showed higher amounts of qITS2_B copies, ranging from 4818 to 13658 (Table 2), with
average (8595; SD= 3075) being almost six times larger than the figure observed in
Torrox (t= 10.18, df= 30, P<0.000001). However, there were not significant differences
in copy number estimations per B between 1B (mean= 8387, N= 5, SD= 2874) and 2B
(mean= 8856, N= 4, SD= 3746) males (t= 0.21, df= 7, P= 0.42).
105
Table 2 Number of qITS2_B copies per genome in different
males from Salobreña and number of copies corresponding to
one B2 in each male.
Id
Bs
qITS2_B Discounting qITS2_B per B
chromosome
0B copies
Sal'10 m7
0
81
Sal'08 m3
0
89
Sal'10 m23
0
96
Mean
89
Sal'10 m1
1
4907
4818
4818
Sal'10 m11
1
7195
7106
7106
Sal'10 m25
1
7698
7609
7609
Sal'10 m10
1
10237
10148
10148
Sal'10 m16
1
12343
12254
12254
Sal'10 m8
2
10779
10690
5345
Sal'10 m13
2
13081
12992
6496
Sal'10 m2
2
19938
19849
9925
Sal'10 m19
2
27405
27316
13658
In order to test the reliability of this result, we performed FISH analysis in six
males (three from each population) with disparate qITS2_B copy number estimations
(highlighted in red in Tables 1 and 2). Even though FISH is not a quantitative technique,
it was apparent that the B chromosomes with higher copy numbers showed larger FISH
signals with rDNA probe (Fig. 2).
Fig. 2 FISH with a 18S rDNA probe (green) and DAPI counterstaining (blue) for X
(left) and B (right) chromosomes from three males collected at Torrox (upper panel) and
three other collected at Salobreña (lower panel). In each male, the X chromosome came
from the same cell as the B chromosome, and is included here for size comparison. Note
that the differences between males for the size of the rDNA cluster in the B
chromosome are parallel to the difference in the number of rDNA units per B
chromosome.
106
Mitotic stability of B chromosomes
No qITS2_B copy number variation among body parts
In order to analyze whether the huge variation in the number of qITS2_B copies was
generated during ontogeny, we analyzed six somatic body parts (antenna, head, gastric
caecum, wing muscle, hind leg and Malphigian tubules) in the same 13 males and 7
females from Torrox where we performed the B presence analysis. Copy number was
transformed to natural logarithms and thus showed a normal distribution (KolmogorovSmirnov test: P>0.20). A mixed-model ANOVA showed the absence of significant
differences in qITS2_B copy numbers among sexes or body parts, but it depended
significantly on the number of B chromosomes, and there was significant interaction
between sex and B number because the sample of males showed higher B frequency
(Table 3). This result indicates the absence of significant variation for the number of
qITS2_B copies during ontogeny of the somatic line.
Table 3 Mixed-model ANOVA of qITS2_B copies in 7 females and 13 males of E.
plorans, with sex and number of B chromosomes (Bs) as fixed factors, and body part
(b.part) as random factor. Six somatic body parts were analyzed in both sexes:
antenna, head, gastric caecum, wing muscle, hind leg and Malphigian tubules.
{1}sex
{2}Bs
{3}b.part
1*2
1*3
2*3
1*2*3
Effect
*Fixed
*Fixed
*Random
Fixed
Random
Random
Random
df
1
3
5
1
5
15
5
MS
0.68
68.32
2.56
16.57
0.30
0.41
0.35
df
4.70
12.91
1.26
4.14
5.94
5.74
67.00
MS
0.30
0.40
0.31
0.33
0.32
0.36
0.77
F
2.23
169.18
8.36
50.79
0.94
1.15
0.45
P value
0.198932
<0.000001
0.201124
0.001805
0.517548
0.465627
0.809379
Discussion
Eyprepocnemis plorans is a grasshopper in which B chromosomes have profusely been
cytologically analyzed in a few body parts showing cell division activity, i.e. testes,
ovarioles and gastric caecum in adults, and ten-day old embryos. The absence of
intraindividual variation for the number of B chromosomes in these body parts indicates
that these Bs are mitotically stable (Camacho et al., 1980; Henriques-Gil et al., 1986).
However, what happens in the rest of the body parts remained unknown. Our present
results clearly indicate that B chromosomes are present in all eight somatic body parts
analyzed (antenna, cerebral ganglion, head, hind leg, wing muscle, Malpighian tubules,
gastric caecum and male accessory gland) in addition to the gonads in both sexes. No
such comprehensive analysis of intraindividual presence of B chromosomes had
hitherto been done in any organism. This leads to the inference that B chromosomes in
the grasshopper E. plorans are present in all body parts, and that they are not eliminated
107
from any somatic body part, thus behaving in a regular way during the mitotic
development of individuals. Knowing this is very important to assess the possible
harmful effects of B chromosomes at the level of the different phenotypic traits, and
allows us to conclude that B chromosomes in this species can potentially exert effects
on every organ or tissue.
Our analysis of copy number for the qITS2_B sequence has revealed several
interesting facts. First, we hitherto believed that this sequence is B-specific because, by
conventional PCR analysis, it was amplified only in B-carrying genomes (Ruíz-Estévez
et al., 2012). However, qPCR has shown the possible presence of a few copies (142 on
average) in the A genome (i.e. in B-lacking individuals). This is suggestive for the
presence of the adenine insertion, on which the R primer was based, in at least one of
the A chromosomes, presumably those from which the B chromosome arose. This needs
further research. Second, the copy number estimations showed a very high range of
variation among B-carrying individuals (208-3970 per B24, and 4818-13658 per B2).
These non-overlapping ranges for both B variants clearly show the dynamic nature of
the rDNA present in the E. plorans B chromosomes, and support previous suggestions
that B24 derived from B2, and that this implied loss of rDNA (Henriques-Gil and Arana
1990; Zurita et al., 1998; Cabrero et al., 1999). Third, the analysis of six somatic body
parts in 7 females and 13 males from Torrox has shown that the number of qITS2_B
copies increases significantly with B chromosome number, but there was not significant
variation among body parts, thus suggesting that ontogeny does not contribute
significantly to increase B chromosome variation for rDNA amount in the somatic line.
The origin of such an extensive variation for rDNA amount in the B
chromosomes of E. plorans, a fact observed in the two natural populations analyzed,
most likely have something to do with meiosis since it is clearly a population fact which
does not occur in somatic body parts within individuals (see above). It has been shown
that B chromosomes in this species do form bivalents when two or more of them are
present during meiotic prophase, and chiasmata are exclusively observed at two
positions (Henriques-Gil et al., 1984). Most frequently, chiasmata are interstitially
located between two C-bands, composed of a 180 bp tandem repeat (López-León et al.,
1994, 1995), but chiasmata can also be observed at distal locations, i.e. where the rDNA
is located. The mean chiasma frequency estimated by Henriques-Gil et al. (1984) was
0.49 and 0.08 for interstitial and distal locations on the B1 chromosome, whereas these
figures were 0.54 and 0.04 for the B 2 one. This gives a chance for unequal crossover to
generate changes in the amount of rDNA carried by B chromosomes of different
individuals from the same population.
A corollary of our present results is that the number of qITS2_B copies can not
be used to ascertain how many B chromosomes there are in a given individual due to
the extensive variation shown by the B chromosomes carried by different individuals.
At cytological level, most B chromosomes observed in different individuals appear to
be the same, but detailed FISH analysis has shown that those found in different
individuals show conspicuous differences in the size of the rDNA FISH signal on the B
chromosome, and that they are roughly correlated with the number of qITS2_B copies
108
Mitotic stability of B chromosomes
estimated by qPCR (see Fig. 2). Previous differential amplification of rDNA has been
reported in barley translocation and duplication lines (Subrahmanyam et al., 1994). It is
also conceivable that extensive variation in rDNA amount can be masked by the high
degree of compaction that the B chromosomes show during cell division, especially at
meiotic stages where they are usually observed.
Our present results have not detected significant differences in the number of
qITS2_B copies among six somatic body parts, suggesting that a B chromosome
essentially carries the same number of copies in all cells within a same individual. This
contrasts with previous observations by Fox (1970) suggesting differential nuclear DNA
replication among different tissues in Schistocerca gregaria and Locusta migratoria,
and with copy number differences for ribosomal genes found among tissues of the same
individual of several plant species (Rogers and Bendich, 1989). But the fact that B
chromosomes sometimes contribute some rDNA transcripts to cells (Ruiz-Estévez et al.,
2012, 2013) opens the possibility that this behavior might differ among tissues, with
varying effects depending on whether these transcripts are fully functional or not. This
is an interesting topic for future research.
In conclusion, we show here how B chromosome presence in the different body
parts from the same individual can be investigated by means of B-specific molecular
markers. We have applied this approach to a mitotically stable B chromosome, and it
has showed that B chromosomes are present in all body parts analyzed. This approach is
even more crucial for mitotically unstable B chromosomes, since it can reveal whether
B chromosome mitotic instability leads to their elimination from any somatic tissue
with the consequent relief of B chromosome harboring and the attenuation of its
harmful effects. Moreover, we have revealed by qPCR and FISH that there is extensive
variation in B-rDNA copy number, for which reason the molecular approach was not
useful for estimating the number of B chromosomes in an individual, or whether all
body parts within an individual carry the same number of B chromosomes.
References
Bidau CJ, Rosato M, Martí DA (2004) FISH detection of ribosomal cistrons and
assortment-distortion
for
X and B
chromosomes in Dichroplus
pratensis (Acrididae).
Cytogenet
Genome
Res
106:295–301.
doi:
10.1159/000079302
Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999) Common origin of B
chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity
83:435-439
Camacho JPM, Carballo AR, Cabrero J (1980) The B chromosome system of the
grasshopper Eyprepocnemis plorans sub. Plorans (Charpentier). Chromosoma
80:163-166
Camacho JPM, Cabrero J (1983) Karyological differences between two species of
grasshoppers genus Acrotylus (Acrididae: Oedipodinae). Caryologia 36 (2): 121127
109
Camacho JPM (2005) B chromosomes. In: Gregory TR, ed. The evolution of the
genome. New York: Academic Press. pp 223–286
Feng J, Zeng R, Chen J (2008) Accurate and efficient data processing for quantitative
real-time PCR using a tripartite plant virus as a model. BioTechniques 44:901912
Fox DP (1970) A non-doubling DNA series in somatic tissues of the
locusts Schistocerca gregaria (Forskål) and Locusta migratoria (Linn.).
Chromosoma 29:446-61
Hall, TA (1999) BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucl. Acids Symp Ser 41:95-98
Henriques-Gil N, Arana P, Santos JL (1984) Factors affecting the meiotic pairing
behaviour of B chromosomes in the grasshopper Eyprepocnemis plorans. Can. J.
Genet. Cytol. 26: 664-668.
Henriques-Gil N, Jones GH, Cano MI, Arana P, Santos JL (1986) Female meiosis
during oocyte maturation in Eyprepocnemis plorans (Orthoptera: Acrididae).
Can J Genet Cytol 28:84-87
Henriques-Gil N, Arana P (1990) Origin and substitution of B chromosomes in the
grasshopper Eyprepocnemis plorans. Evolution 44:747-753
Jackson WD, Cheung DSM (1967) Distortional meiotic segregation of a supernumerary
chromosome producing differential frequencies in the sexes in the short-horned
grasshopper Phaulacridium vittatum. Chromosoma 23(1):24-37
John B, Hewitt GM (1965) The B-chromosome system of Myrmeleotettix maculatus
(Thunb.). I. The mechanics. Chromosoma 16(5): 548-578
Jones RN (1995) Tansley review no. 85: B chromosomes in plants. New Phytol 131:
411-434
Kayano H (1971) Accumulation of B chromosomes in the germ-line of Locusta
migratoria. Heredity 27:119–123
Lima-de-Faria A (1959) Differential uptake of tritiated thymidine into hetero- and
euchromatin in Melanoplus and Secale. J Biophys Biochem Cytol 6:457–466
López-León MD, Neves N, Schwarzacher T, Heslop-Harrison TS, Hewitt GM,
Camacho JPM (1994). Possible origin of a B chromosome deduced from its
DNA composition using double FISH technique. Chromosome Res. 2:87–92.
López-León MD, Vázquez P, Hewitt GM, Camacho JPM (1995). Cloning and sequence
analysis of an extremely homogeneous tandemly repeated DNA in the grasshopper
Eyprepocnemis plorans. Heredity 75:370-375.
Mendelson D, Zohary D (1972) Behaviour and transmission of supernumerary
chromosomes in Aegilops speltoides. Heredity 2:329-339
Mochizuki A (1957) B chromosomes in Aegilops mutica Boiss. Wheat Inform. Serv.
5:9-11
Muñoz-Pajares AJ, Martínez-Rodríguez L, Teruel M, Cabrero J, Camacho JPM,
Perfectti F (2011). A Single, recent origin of the accessory B chromosome of the
grasshopper Eyprepocnemis plorans.Genetics 187:853–863
Nur U (1969) Mitotic instability leading to an accumulation of B-chromosomes in
grasshoppers. Chromosoma 27(1):1-19
Ohta S (1986) A study on B chromosomes in Aegilops mutica Boiss. 1. Distribution
within individuals and transmission. Jpn J Genet 6:608-609
Pardo MC, Lopez-Leon MD, Viseras E, Cabrero J, Camacho JPM (1995) Mitotic
instability of B chromosomes during embryo development in Locusta
migratoria. Heredity 74:164–169. doi:10.1038/hdy.1995.24
110
Mitotic stability of B chromosomes
Remis MI, Vilardi JC (2004) Mitotically unstable B chromosome polymorphism in
the grasshopper Dichroplus elongatus. Cytogenet Genome Res 106(2-4):359364
Rogers SO, Bendich AJ (1987) Ribosomal RNA genes in plants: variability in copy
number and in the intergenic spacer. Plant Molcelular Biology 9:509-520
Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome
Ribosomal DNA is functional in the grasshopper Eyprepocnemis plorans. PLoS
ONE 7(5): e36600. doi:10.1371/journal.pone.0036600
Ruíz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is
active in different B chromosome variants of the grasshopper Eyprepocnemis
plorans. Genetica 141:337-345
Rutishauser A, Röthlisberger E (1966) Boosting mechanism of B chromosomes in
Crepis capillaris. Chromosomes Today 1:28–30
Rutledge RG, Stewart D (2008) A kinetic-based sigmoidal model for the polymerase
chain reaction and its application to high-capacity absolute quantitative real-time
PCR.BMC Biotechnol 8:47
Sommeregger W, Prewein B, Reinhart D, Mader A, and Kuner R (2013) Transgene
copy number comparison in recombinant mammalian cell lines: critical
reflection of quantitative real-time PCR evaluation. Cytotechnology 65:811–818
Subrahmanyam NC, Bryncelsson T, Hagberg P, Hagberg A (1994) Differential
amplification of rDNA repeats in barley translocation and duplication lines: role
of a specific segment. Hereditas 121:157-170
StatSoft, Inc. (2007) STATISTICA (data analysis software system), version 8.0.
www.statsoft.com
Taylor JH (1960) 464 Asynchronous duplication of chromosomes in cultured cells of
Chinese hamster. J Biophys Biochem Cytol 7:455–464
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during
meiosis and NOR activity of a B chromosome in the grasshopper Eyprepocnemis
plorans. Chromosome Res 15:755–765
Teruel M (2009) Origen, expresión y efectos fenotípicos de un parásito
genómico. PhD. Universidad de Granada
Timothy D, Littlewood J, Olson PD (2000) Small subunit rDNA and the
platyhelminthes: signal, noise, conflict and compromise. In: Interrelationships of
the Platyhelminthes (eds. D.T.J. Littlewood & R.A. Bray). CRC Press. UK. 380
pp
Zurita S, Cabrero J, López-León MD, Camacho JPM (1998) Polymorphism
regeneration for a neutralized selfish B chromosome. Evolution 52:274–277
111
112
Capítulo 6. Ribosomal DNA on a B
chromosome shows differential expression
level in several body parts of the grasshopper
Eyprepocnemis plorans
113
114
Ribosomal DNA on a B chromosome shows differential expression
level in several body parts of the grasshopper Eyprepocnemis plorans
Mercedes Ruiz-Estévez1, Jozef Vanden Broeck2, Francisco Perfectti1, Mª Dolores
López-León1, Josefa Cabrero1, Juan Pedro M. Camacho1*
1 Departamento de Genética, Facultad de Ciencias, Universidad de Granada, 18071
Granada, Spain
2 Animal Physiology and Neurobiology, Zoological Institute, K.U. Leuven,
Naamsestraat, 59, B-3000 Leuven, Belgium
Short title: rDNA differential expression in body parts
Keywords: B chromosome, rDNA, differential expression, qRT-PCR
115
Abstract
Ribosomal DNA (rDNA) plays a main role in ribosome biogenesis, a central process in
cellular biology influencing cell growth and development. rDNA is also one of the two
main repeated DNA sequences composing the supernumerary (B) chromosomes of the
grasshopper Eyprepocnemis plorans. The heterochromatic nature of these B
chromosomes suggested their genetic inertness, but the activity of their rDNA detected
by cytological and molecular methods have completely changed this view. Here we test,
by means of qRT-PCR for a target sequence specific to B chromosomes, whether the BrDNA is active in six different body parts of nine B-carrying males where B-rDNA
activity had previously been detected. We found that B-rRNA transcripts were present
in RNA extracted from all six body parts analyzed (head, hind leg, wing muscle, testis,
accessory gland and gastric caecum) and that their frequency increases with B
chromosome number. There were also significant differences in relative quantification
(RQ) values between the six body parts analyzed, with three of them (testis, accessory
gland and wing muscle) showing three times higher RQ than the three other,
presumably due to higher rRNA requirements in the moment at which they were frozen.
It was remarkable that two of the body parts showing higher contribution of rRNA by
the B chromosome (testis and accessory gland) are involved in male reproduction,
whereas the third (wing muscle) is important for survival. The possible meanings of
these apparently beneficial effects on males are discussed in the light of the current
theories of B chromosome evolution.
Introduction
In eukaryotes, 45S ribosomal DNA (rDNA) is one of the most abundant tandem
repetitive DNAs in the genome. Each cistron contains three ribosomal (rRNA) genes,
18S, 5.8S and 28S, separated by the Internal Transcribed Spacers 1 and 2 (ITS1 and
ITS2) and flanked by the External Transcribed Spacers (ETSs) and the Intergenic
Spacer (IGS) (Long and David, 1980). After transcription, the rRNA gene products will
form part of the two ribosome subunits and the ITSs are eliminated during transcript
maturation (Sollner-Webb y Tower, 1986). The rDNA array is placed at the secondary
constrictions of the chromosomes, where the Nucleolar Organizer Regions (NORs) are
located (Heitz, 1931; McClintock, 1934).
Activation of rDNA transcription is dependent on cell status, with high energetic
requirements being accompanied by high transcription rates. However, only about 50%
of the rDNA repeats are usually transcribed (Reeder, 1999) at a given moment. The
phenotypic visualization of rRNA transcription is the nucleolus, which appears attached
to the NORs. The size of the nucleolus is positively correlated with the rate of rRNA
synthesis (Mosgoeller, 2004). Since the nucleolus is constituted by acidic and highly
argyrophilic proteins, a simple silver impregnation technique is enough to visualize
them (Rufas at al., 1982). This technique specifically reveals the transcriptional
116
rDNA differential expression in body parts
machinery of the RNA polimerase I, including the B23, nucleolin, UBF proteins and
RNA pol I subunits (Roussel at al., 1992; Roussel and Hernandez-Verdun 1994;
Roussel at al., 1996).
Eyprepocnemis plorans is a grasshopper species which possesses an extra
amount of rDNA located in supernumerary (B) chromosomes. This species shows a
standard (A) genome composed by 22 + X0/XX chromosomes, and a high variety of B
chromosomes, i.e. dispensable chromosomes which do not recombine with A
chromosomes and do not follow Mendelian rules (for review, see Camacho at al., 2003;
Camacho, 2005). B chromosomes are mainly composed of repetitive DNA sequences,
such as ribosomal DNA (rDNA), satellite DNA (satDNA) and transposable elements.
Due to the heterochromatic nature of B chromosomes, they were considered for long as
genetically inert elements. Activity of the B-rDNA in E.plorans was first reported by
Cabrero at al. (1987) in a male carrying the B chromosome fused to the longest
autosome. Teruel at al. (2007) later showed that this was not a unique case, by finding
recurrent B-NOR activity in the Torrox population, a fact that has been corroborated by
detecting B-specific ITS2 rDNA transcripts (Ruiz-Estévez at al., 2012), based on a
characteristic adenine insertion being found only in ITS2 sequences obtained from
microdissected B chromosomes (Teruel et al., submitted). More recently, it has been
shown that B chromosomes belonging to other variants also show B-NOR activity in
several Spanish populations although at rates lower than that observed in Torrox (RuizEstévez at al., 2013). All previous studies of B-rDNA activity in E.plorans have been
performed cytogenetically in testes and molecularly in samples of the whole body
without distinguishing among body parts, so it was impossible to know whether B
activity was a general characteristic or else there are differences among cell types. Here,
our main aim is to answer the questions: Is B-rDNA expression a phenomenon
occurring in all body parts of a male? If the answer is yes, is there differential
expression between body parts?
The first example of differential rDNA expression was detected in
Plasmodium berghei, where different rRNA “types” were transcribed depending on the
stage of the life cycle (Gunderson at al., 1987). Previous results have shown that 18S
transcription is regulated in different cell and tissue types, depending on the protein
synthesis required by the individual (Hanna at al., 1998). Differential rDNA expression
between tissues has recently been detected in abalone Haliotis tuberculata (Van
Wormhoudt at al., 2011). However, the possibility of B-rDNA differential expression
among body parts has not yet been analyzed in any animal. However, differential
expression of B chromosome sequences between plant tissues has recently been reported
in rye, in a study focused on pseudogene-like fragments residing in a B chromosome
(Banaei-Moghaddam at al., 2013).
Here we analyze molecularly the differential rDNA expression of the B 24
chromosome in several body parts (head, hind leg, wing muscle, testis, accessory gland
and gastric caecum) of males where previously we had detected active B-NORs in the
gonads by silver impregnation. We detected the presence of B-rDNA transcripts in all
body parts analyzed and the relative quantity of B-specific transcripts varied among
them.
117
Materials and methods
Biological samples
A sample of 23 males of the grasshopper Eyprepocnemis plorans was collected in the
Torrox population (Málaga, Spain). At the laboratory, they were anesthetized and
dissected to remove a portion of each testicle which was then fixed in freshly prepared
3:1 ethanol–acetic acid and stored at 4°C for cytological analysis. At the same time, we
dissected, under a stereomicroscope, different body parts (head, hind leg, wing muscle,
testes, accessory gland and gastric caecum), which were frozen in liquid nitrogen and
stored at -80ºC for molecular studies. Determination of B number in each male was
performed by squashing two testis tubules in 2% lacto-propionic orcein. rDNA
expression of the B chromosome was first analyzed by submitting testis follicles to
silver impregnation following the protocol described in Rufas at al. (1982), with an
additional 1% Giemsa stain step to differentiate the chromatin (blue-green) from the
nucleoli (brown). In both techniques, we visualized primary spermatocytes at prophase
or metaphase I under an Olympus microscope (DP70). At least 20 diplotene cells per
male were visualized to analyze B-rDNA expression, manifested by the presence of
nucleoli attached to the B chromosomes.
Total RNA extractions and complementary DNA (cDNA) synthesis
Total RNA extractions from frozen body parts were performed using Lipid Tissue Mini
Kit (Qiagen) following manufacturer’s recommendations. After extraction, we
submitted the RNA to another 20U DNase post-treatment (RNase-Free DNase Set,
Qiagen) to discard any genomic DNA contamination. Quantity and purity of the RNA
were measured with a NanoDrop spectrophotometer (version 3.1.2., NanoDrop
Technologies, Inc. Wilmington, DE. USA), and the quality was checked in a denaturing
agarose gel to ensure the absence of nucleic acid degradation. We reverse-transcribed
100 ng per sample of total RNA (PrimeScript™ RT reagent Kit, Perfect Real Time,
Takara) using a combination of random and oligo dT primers. The resulting cDNA was
diluted in RNase-DNase free water 1:10 (work solution).
B-rDNA expression in different body parts
Target and housekeeping genes primers
B-rDNA expression analysis was performed in the six body parts of 9 males showing
active B-NOR in the testis. For this purpose, we amplified in the cDNA the qITS2_B
target sequence, which is part of the ITS2_B, a DNA sequence being specific to B
chromosomes (Teruel et al., submitted; Ruiz-Estévez et al., 2012), but with primers
designed to yield a short sequence of only 152 bp, which is more appropriate for qPCR.
118
rDNA differential expression in body parts
qIT2_B was amplified using the same reverse primer as the ITS_B sequence and a new
forward primer (ITSD: 5’ ACTTGGGAGCGTCGTGGTA 3’), designed using the
Primer 3 v.0.4.0 software. To amplify the housekeeping genes (HKGs), we used the
primers provided by Van Hiel et al. (2009) and Chapuis at al. (2011) for Tubulin
(TubA1), Armadillo (Arm), Actin (Act), GAPDH, Ubiquitin (Ubi), Elongation Factor
1α (EF1α), Ribosomal Protein 49 (RP49) and CG13220. Primers for both target and
HKGs were tested by quantitative retrotranscription-polymerase chain reaction (qRTPCR) with different conditions (see below). PCR products were visualized in a 1.5%
agarose gel, cleaned with Gen EluteTM PCR Clean-Up Kit (Sigma), sequenced by
Macrogen Inc, and analyzed with BioEdit software (version 7.1.3.0.) (Hall 1999) before
searching for sequence homologies at the NCBI site using BLAST (Basic Local
Alignment Search tool).
Housekeeping reference genes validation and relative quantification of B-rDNA
expression
After ensuring the specificity of the HKGs primers, we determined the most stable
HKGs in our samples carrying out a geNorm analysis. Standard curves were used to
determine the efficiency of the selected HKGs. Then we estimated the relative
expression level of qITS2_B in the body parts performing qRT-PCR. The reaction
mixtures contained 5µl 2X SensiMixTM SYBR Mastermix (SensiMixTM SYBR Kit,
Bioline), 0.7µM each forward and reverse primer and 5ng cDNA, in a final volume of
15µl. We performed two types of qRT-PCRs due to the need of different PCR
conditions, one for HKGs and other for target gene amplifications, since the latter
required fine tuning of the reverse primer and high melting temperature to avoid
unspecific amplification. We amplified the same calibrator sample (comprising cDNA
synthesized from RNA of different body parts) in each run to ensure that data resulting
from the experimental samples were comparable. qRT-PCR assays were run in the
Chromo4 Real Time PCR thermocycler (BioRad), and PCR conditions were the
following: an initial denaturation at 95ºC for 10 min, 40 cycles of 94ºC for 30 s, 60ºC for
30 s (HKGs) or 73.2ºC for 15 s (target sequence), 72ºC for 15 s, and a melting curve step
to check the specificity of the reaction. We included a negative control without cDNA to
ensure that the reagents were free of contaminating DNA. Where possible, reagents were
combined in mixed solutions to minimize the number of manipulations, and each sample
was amplified in triplicate and the entire experiment was done in duplicate. Opticon
Monitor v3.1. software was used to export the qRT-PCR raw data from the Chromo4
instrument and Relative Quantification (RQ) of the transcript was obtained following the
“Efficiency calibrated mathematical method for the relative expression ratio in real-time
PCR” (Roche Applied Science, Technical Note No. LC 13/2001).
119
Statistical analysis
To compare RQ levels between the six body parts analyzed from nine males with two
replicates, we performed a generalized randomized block design, with individual as a
random block and body part as a fixed factor. The statistical analysis was made in R (R
Development Core Team, 2008) by means of a linear mixed-effects model (LMM), with
post-hoc multiple comparisons by Tukey contrasts.
Results and discussion
To analyze the relative B-rDNA expression between body parts, by qRT-PCR, we chose
9 males with active B-NOR, i.e., showing nucleoli attached to a B chromosome in
diplotene cells (Fig. 1). Four of these males carried 1B, three 2B, one 3B and one 4B.
Fig. 1 Diplotene cell from a Torrox male carrying 3B chromosomes, one of them
showing an attached nucleolus (B= B chromosome; X= X chromosome; nu= nucleolus).
Bar= 5µm.
Total RNA extracted from the body parts of the 9 males and subsequently
DNase retreated showed high purity as was indicated by the absorbance ratio 260:280
nm (=1.9-2). Some of the HKGs showed two peaks (unspecific amplification) in the
melting curve graph (results not shown), for which reason they were rejected as
reference genes. After sequencing and confirming the three remaining HKGs (RP49,
Tub1A and Armadillo), the geNorm analysis determined that Tub1A and Armadillo were
the most stable HKGs in our samples. HKGs and target primers showed amplification
efficiency values of 95-105%. The target sequence qITS2_B had homology with the
ITS2
120
rDNA differential expression in body parts
sequences reported by Teruel at al. (submitted) for this species (accession numbers:
JN811827 to JN811902).
We obtained amplification of the qITS2_B sequence in the cDNA of each body
part of the nine males (see Table S1), with the single exception of the gastric caecum of
one of the 1B males. This suggests that the expression of the rDNA of the B
chromosome takes place in all body parts analyzed, and is not restricted to the gonads
only.
The RQ values for qITS2_B expression showed significant differences between
the body parts of the 9 males (LMM: F= 8.21, df= 5, 92, P<0.0001), with three of them
(testis, male accessory gland and wing muscle) showing RQ values about three times
higher than those of the three remaining ones (hind leg, gastric caecum and head) (Figure
2). Multiple post-hoc comparisons, by means of Tukey contrasts, indicated that the
differences between these two kinds of body parts were significant (Table S2).
3,0
2,5
RQ
2,0
1,5
1,0
0,5
0,0
H
HL
WM
T
AG
GC
M ean
M ean±SE
M e a n ± 1 ,9 6 *S E
Fig. 2 Expression levels of the qITS2_B in six body parts of 9 males carrying active B 24
chromosomes. (H= Head, HL= Hind leg, WM= Wing muscle, T= Testis, AG=
Accessory gland, GC= Gastric caecum).
It is conceivable that this differential expression of the B-rDNA between body
parts could have something to do with higher demands for rRNA in them, at least at the
moment at which they were frozen. It has been shown in E.plorans testis that total cell
nucleolar area (NA) did not show intraindividual significant difference between cells
showing active B-NORs and those showing inactive ones, suggesting that total cell
121
demands for rRNA are tightly regulated, irrespectively of how many chromosomes are
contributing rRNA (Teruel at al., 2007, 2009). Therefore, it is possible that some tissues
at certain moments of higher metabolic activity (in terms of protein synthesis) could take
advantage of the rRNA produced in the nucleoli organized by the B chromosome.
Differential expression of the qITS2_B (i.e. B-rDNA) could be due to structural
and/or epigenetic changes in the DNA or chromatin, among other causes. For instance,
differential amplification of B-rDNA repeats in some tissues could result in different
rDNA copy number between tissues, and the differential expression could simply be
dependent on copy number. Differential amplification of rDNA repeats has been
reported in barley (Subrahmanyam at al., 1994), but this possibility has not been tested in
E.plorans. In the second case, epigenetic systems are memory mechanisms that are
inherited between generations and establish gene function. The most known epigenetic
marks (DNA methylation and histone modification) are involved in the expression of
some genes and transcription factors specific to cell or tissue types (Shen and Maniatis,
1980; Cho at al., 2001; Imamura at al., 2001; Hattori at al., 2004b, 2007; Nishino at al.,
2004).
It has been shown that each cell or tissue type has its own methylation pattern
(Ohgane at al., 1998; Shiota at al., 2002; Strichman-Almashanu at al., 2002) in
association with tissue-specific function. In the mice, for instance, there are
hypomethylated regions in the liver in genes specifically expressed in that tissue, and
this methylation profile is different from the ones in kidney and spleen (Yagi at al.,
2008). Some studies on human promoter regions have suggested that DNA methylation
status is correlated with transcription activity of some genes (Weber at al., 2005, 2007).
On the other hand, histone modifications or the presence of specific histone variants
influence the interactions between the transcription factors and the chromatin fiber
(Ruthenburg at al., 2007). In mammals, embryonic development requires a tissuespecific expression of different genes, and it is regulated by enhancers showing histone
modifications (Cotney at al., 2012). Furthermore, histone modification has been reported
to affect DNA methylation in a locus-specific manner (Ikegami at al., 2007). In this
context, B chromosomes in E. plorans have shown to be differentially methylated in the
B-rDNA region, which explained their usual lack of NOR activity (López-León et al.,
1991, 1995). In addition, they are differentially hypoacetylated for lysine 9 in the H3
histone (Cabrero et al. 2007). It would thus be interesting to investigate whether B-rDNA
is subject to differential degrees of epigenetic silencing mechanisms in the body parts
analyzed here.
Taken together, our results have revealed that the rDNA of the B 24 chromosome
is active not only in the gonad, but also in somatic body parts; with significantly higher
expression levels in testis, accessory gland and wing muscle, thus implying the B
chromosome’s apparent contribution to grasshopper reproduction and survival. This is
puzzling for B chromosomes behaving as true parasites in females, where they show
meiotic drive (Herrera et al., 1996) and significantly reduce egg fertility (Zurita et al.,
1998). The biological meaning of B chromosomes contribution of rRNA in male body
parts will logically depend on whether the rRNA sequences provided by the B are fully
functional and on the proportion they represent within the total rRNA molecules
122
rDNA differential expression in body parts
produced by the A chromosomes in the same body parts. The latter proportion appears
to be low since the frequency of B-carrying males showing B-NOR activity is usually
lower than 50% and, within these males, the proportion of cells showing nucleoli
produced by the B chromosome is not higher than 29% (Teruel et al., 2007, 2009; RuízEstévez et al., 2012, 2013).
Our recent analysis of the ITS2 region and part of the coding regions in the 5.8S
and 28S rRNA genes, by means of 454 amplicon sequencing (Ruíz-Estévez et al., in
preparation), suggests that the rRNA sequences produced by the B chromosome are
fully functional. Therefore, if the B chromosome is contributing functional rRNA to
cells, we could argue that its parasitic role is diminished (by tending to be beneficial to
males) because it is actually promoting host reproduction through its contribution of
rRNA in testes and male accessory gland, as well as escape from predators through
flight, by its contribution of rRNA in wing muscle. In strictly vertical parasites, like B
chromosomes, the parasite fitness is completely linked to host fitness (Muñoz et al.,
1998), and any contribution of a B chromosome to host survival and reproduction
logically also benefits the parasite itself. In any case, it would be interesting to measure
the transcendence of this molecular contribution of the B chromosome to male fitness, a
task to be undertaken in future research.
Acknowledgements We thank Karl Meunier for language revision. This study was supported
by a grant from the Spanish Ministerio de Ciencia e Innovación (CGL2009-11917) and Plan
Andaluz de Investigación (CVI-6649), and was partially performed by FEDER funds. M RuízEstévez was supported by a FPU fellowship from the Spanish Ministerio de Ciencia e
Innovación. The authors also gratefully acknowledge the KU Leuven Research Foundation
(GOA/11/02) and the Research Foundation of Flanders (Belgium) for financial support.
References
Banaei-Moghaddam AM, Meier K, Karimi-Ashtiyani R, and Houben A (2013)
Formation and expression of pseudogenes on the B chromosome of rye. The Plant
Cell 25:2536–2544
Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the
grasshopper Eyprepocnemis plorans on nucleolar organizer regions activity.
Activation of a latent NOR on a B chromosome fused to an autosome. Genome
29:116–121
Cabrero J, Teruel M, Carmona FD, Jiménez R, Camacho JPM (2007) Histone H3 lysine
9 acetylation pattern suggests that X and B chromosomes are silenced during
entire male meiosis in a grasshopper. Cytogenet Genome Res 119:135–142
Camacho JPM., Cabrero J, López-León MD, Bakkali M, and Perfectti F (2003) The B
chromosomes of the grasshopper Eyprepocnemis plorans and the intragenomic
conflict. Genetica 117:77-84
Camacho JPM (2005) B Chromosomes. In: Gregory TR, ed., The Evolution of the
Genome. San Diego: Elsevier, pp. 223Y286
123
Chapuis MP, Tohidi-Esfahani D, Dodgson TBlondin L, Ponton F, Cullen D, Simpson SJ,
Sword GA (2011) Assessment and validation of a suite of reverse transcriptionquantitative PCR reference genes for analyses of density-dependent behavioural
plasticity in the Australian plague locust. BMC Mol Biol 12:7
Cho J, Kimura H, Minami T, Ohgane J, Hattori N, Tanaka S, and Shiota K (2001) DNA
methylation regulates placental lactogen I gene expression. Endocrinology
142:3389-3396
Cotney J, Leng J, Oh S, DeMare LE, Reilly SK, Gerstein MB, and Noonan JP (2012)
Chromatin state signatures associated with tissue-specific gene expression and
enhancer activity in the embryonic limb Genome Res 22:1069-1080
Gunderson JH, Sogin ML, Wollett G, Hollingdale de la Cruz VF, Waters AP,
McCutchan TF (1987) Structurally distinct, stagespecific ribosomes occur in
Plasmodium. Science 238:933-937
Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41:95–98
Hannan KM, Hannan RD, Rothblum LI (1998) Transcription by RNA polymerase I.
Front Biosci 3:376-398
Hattori N, Nishino K, Ko Y, Hattori N, Ohgane J, Tanaka S, and Shiota K (2004b)
Epigenetic control of mouse Oct-4 gene expression in embryonic stem cells and
trophoblast stem cells. J Biol Chem 279:17063-17069
Hattori N, Imao Y, Nishino K, Hattori N, Ohgane J, Yagi S, Tanaka S, and Shiota K
(2007) Epigenetic regulation of Nanog gene in embryonic stem and trophoblast
stem cells. Genes Cells 12:387-396
Heitz E (1931) Die Ursache der gesetzmässigen Zahl, Lage, From und Grösse
pflanzlicher Nukleolen. Planta 12:775-844
Herrera JA, López-León MD, Cabrero J, Shaw MW, and Camacho JPM (1996)
Evidence for B chromosome drive suppression in the grasshopper Eyprepocnemis
plorans. Heredity 76:633-639
Ikegami K, Iwatani M, Suzuki M, Tachibana M, Shinkai Y, Tanaka S, Greally J, Yagi
S, Hattori N, and Shiota K (2007) Genome-wide and locus-specific DNA
hypomethylation in G9a deficient mouse embryonic stem cells. Genes Cells 12: 111
Imamura T, Ohgane J, Ito S, Ogawa T, Hattori N, Tanaka S, and Shiota K (2001) CpG
island of rat sphingosine kinase-1 gene: Tissue-dependent DNA methylation
status and multiple alternative first exons. Genomics 76:117–125
Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem 49:727764
López-León MD, Cabrero J, and Camacho, JPM (1991) Meiotic drive against an
autosomal supernumerary segment promoted by the presence of a B chromosome
in females of the grasshopper Eyprepocnemis plorans. Chromosoma 100:282-287
López-León MD, Vázquez P, Hewitt GM, and Camacho JPM (1995) Cloning and
sequence analysis of an extremely homogeneous tandemly repeated DNA in the
grasshopper Eyprepocnemis plorans. Heredity 75:370-375
McClintock DJL (1934) The relation of a particular chromosomal element to the
development of the nucleoli in Zea mays. Z. Zellforsch. Mikrosk. Anat. 21:294328
Mosgoeller W (2004) Nucleolar ultrastructure in vertebrates. In: Olson MOJ, ed., The
Nucleolus. New York: Kluwer, pp. 10-20
124
rDNA differential expression in body parts
Muñoz E, Perfectii F, Martín-Alganza A, and Camacho JPM (1998) Parallel effect of a
B chromosome and a mite decreasing female fitness in the grasshopper
Eyprepocnemis plorans. Proc R Soc Lond Ser B. 265:1903-1909
Nishino K, Hattori N, Tanaka S, and Shiota K (2004) DNA methylation-mediated
control of Sry gene expression in mouse gonadal development. J Bio Chem 279:
22306–22313
Ohgane J, Aikawa J, Ogura A, Hattori N, Ogawa T, and Shiota K (1998) Analysis of
CpG islands of trophoblast giant cells by restriction landmark genomic scanning.
Dev Genet 22:132–140
R Development Core Team (2008). R: A language and environment for statistical
computing. R Foundation for Statistical Computing, Vienna, Austria. ISBN 3900051-07-0. www.R-project.org.
Reeder RH (1999) Regulation of RNA polymerase I transcription in yeast and
vertebrates. Prog Nucleic Acid Res Mol Biol 62:293-327
Roussel P, Belenguer P, Amalric F, Hernandez-Verdun D (1992) Nucleolin is an AgNOR protein; this property is determined by its amino-terminal domain
independently of its phosphorylation state. Exp Cell Res 203:259–269
Roussel P, Hernandez-Verdun D (1994) Identification of Ag-NOR proteins, markers of
proliferation related to ribosomal gene activity. Exp Cell Res 214:465–472
Roussel P, Andre C, Comai L, Hernandez-Verdun D (1996) The rDNA transcription
machinery is assembled during mitosis in active NORs and absent in inactive
NORs. J Cell Biol 133:235–246
Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver staining procedure for
the localization of nucleolus and nucleolar organizer under light and electron
microscopy. Arch Biol 93:267–274
Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome
Ribosomal DNA is functional in the grasshopper Eyprepocnemis plorans. PLoS
ONE 7(5):e36600. doi:10.1371/journal.pone.0036600
Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is
active in different B chromosome variants of the grasshopper Eyprepocnemis
plorans. Genetica. doi: 10.1007/s10709-013-9733-6
Ruthenburg AJ, Li H, Patel DJ, Allis CD (2007) Multivalent engagement of chromatin
modifications by linked binding modules. Nature Reviews Mol Cell Bio 8:983–
994
Shen C, and Maniatis T (1980) Tissue-specific DNA methylation in a cluster of rabbit
beta-like globin genes. Proc Natl Aca. Sci 77: 6634–6638
Shiota K, Kogo Y, Ohgane J, Imamura T, Urano A, Nishino K, Tanaka S, and Hattori N
(2002) Epigenetic marks by DNA methylation specific to stem, germ and somatic
cells in mice. Genes Cells 7:961–969
Sollner-Webb B, Tower J (1986) Transcription of cloned eukaryotic ribosomal RNA
genes. Annu Rev Genet 55:801-830
StatSoft, Inc. (2007) STATISTICA (data analysis software system), version 8.0.
www.statsoft.com
Strichman-Almashanu LZ, Lee RS, Onyango PO, Perlman E, Flam F, Frieman MB, and
Feinberg AP (2002) A genome-wide screen for normally methylated human CpG
islands that can identify novel imprinted genes. Genome Res. 12:543–554
Subrahmanyam NC, Bryngelsson T, Hagberg P, Hagberg A (1994) Differential
amplification of rDNA repeats in barley translocation and duplication lines: role
of a specific segment. Hereditas 121:157–170
125
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during
meiosis and NOR activity of a B chromosome in the grasshopper Eyprepocnemis
plorans. Chromosome Res 15:755–765
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR
expression in a B chromosome of the grasshopper Eyprepocnemis plorans.
Chromosoma 118:291–30
Van Hiel MB, Van Wielendaele P, Temmerman L, Van Soest S, Vuerinckx K,
Huybrechts R, Broeck JV, Simonet G (2009) Identification and validation of
housekeeping genes in brains of the desert locust Schistocerca gregaria under
different development conditions. BMC Mol Biol 10:56. doi:
10.1186/1471-2199-10-56
Van Wormhoudt A, Gaume B, Le Bras Y, Roussel V, Huchette S (2011) Two different
and functional nuclear rDNA genes in the abalone Haliotis tuberculata: tissue
differential expression. Genetica 139:1217–1227
Weber M, Davies J, Wittig D, Oakeley E, Haase,M, Lam W, and Schübeler D (2005)
Chromosome-wide and promoter-specific analyses identify sites of differential
DNA methylation in normal and transformed human cells. Nat Genet 37:853–862
Weber M, Hellmann I, Stadler M, Ramos L, Pääbo S, Rebhan M, and Schübeler D
(2007) Distribution, silencing potential and evolutionary impact of promoter DNA
methylation in the human genome. Nat Genet 39:457–466
Yagi S, Hirabayashi K, Sato S, Li W, Takahashi Y, Hirakawa Y, Wu G, Hattori N,
Hattori N, Ohgane J, Tanaka S, Liu XS, and Shiota K (2008) DNA methylation
profile of tissue-dependent and differentially methylated regions (T-DMRs) in
mouse promoter regions demonstrating tissue-specific gene expression. Genome
Res 18:1969-1978
Zurita S, Cabrero J, López-León MD, and Camacho JPM (1998) Polymorphism
regeneration for a neutralized selfish B chromosome. Evolution 52:274–277
126
rDNA differential expression in body parts
Supporting Information
Table S1 Relative Quantification values of the qITS2_B in 6 different body
parts of the nine E.plorans males analyzed. These males carried active B 24 in
the gonads. H= Head, HL= Hind leg, WM= Wing muscle, T= Testis, AG=
Accessory gland, GC= Gastric caecum.
RQ values of qITS2_B in different body parts of
E.plorans
Id
Nº Bs
H
HL
WM
T
AG
GC
TII'10 m12
1
1.529
1.611
1.044
0.164
0.004
0.136
TII'11 m9
1
0.222
0.033
1.425
3.588
3.636
0.076
T0'11 m7
1
0.323
0.248
1.943
1.698
0.470
0.501
TII'11 m1
1
0.080
0.006
0.244
0.450
1.042
0.000
T0'11 m4
2
0.148
0.250
0.338
0.718
0.253
1.305
TII'11 m8
2
-
0.007
3.366
2.099
1.181
0.007
TII'11 m4
2
0.078
0.803
2.525
3.710
3.669
0.101
TII'10 m16
3
0.210
1.044
1.364
2.828
3.212
1.741
TII'10 m14
4
1.250
1.016
2.914
1.651
2.802
1.370
Mean 0.480
0.558
1.685
1.879
1.808
0.582
Table S2 Multiple post-hoc comparisons among the six body parts by means of
Tukey contrasts. Z and P values are placed above and below diagonal, respectively.
H= Head, HL= Hind leg, WM= Wing muscle, T= Testis, AG= Accessory gland, GC=
Gastric caecum. Significant P values are in bold-type letter.
H
H
HL
WM
T
AG
GC
0.99994
0.00704
<0.001
0.0018
0.99974
HL
0.216
0.01007
0.00111
0.00262
1
WM
3.463
3.362
0.99245
0.99913
0.01285
T
4.022
3.94
0.579
0.99994
0.00157
AG
3.818
3.729
0.367
0.211
GC
0.286
0.073
3.289
3.867
3.656
0.00346
127
128
Capítulo 7. HP1 knockdown is associated
with abnormal condensation of almost all
chromatin types
129
130
HP1 knockdown affects both eucromatin and heterochromatin
HP1 knockdown is associated with abnormal condensation of almost
all chromatin types
Mercedes Ruiz-Estévez, Mohammed Bakkali, Josefa Cabrero, Juan Pedro M. Camacho,
María Dolores López-León
Departamento de Genética, Facultad de Ciencias, Universidad de Granada, 18071
Granada, Spain
Short title: HP1 knockdown affects both eucromatin and heterochromatin.
Keywords:
Heterochromatin
protein
1;
RNAi;
eucromatin;
heterochromatin;
Eyprepocnemis plorans; qRT-PCR.
131
Abstract
Heterochromatin protein 1 (HP1) is a highly conserved family of eukaryotic proteins
required for heterochromatic gene silencing and euchromatic gene transcription
regulation. In addition, HP1 is involved in chromatin organization and protection of
chromosome integrity during cell division. Here, we present a cytological and molecular
analysis of the effects HP1 knockdown in Eyprepocnemis plorans, a grasshopper
species polymorphic for supernumerary heterochromatic chromosomes. Our results
revealed contrasting effects of HP1 knockdown on gene activity. While the Bub1 gene
decreased in expression level in HP1 knockdown animals, NOR activity, rRNA and,
contrarily to previous reports in Drosophila, Hsp70 gene expression remained
unchanged. Furthermore, HP1 knockdown resulted in abnormal chromatin
condensation, chromosomal bridges, higher frequency of macroespermatids, loss of
muscle mass and hemolymph amount as well as a low number of dividing cells and
survival reduction. All these phenotypes are very likely due to the characteristic pattern
of chromatin condensation disruption observed for almost all kinds of chromatin.
Introduction
Heterochromatin protein 1 (HP1) is a eukaryotic non-histone chromosome-associated
protein initially identified in Drosophila melonogaster (James and Elgin, 1986).
Although HP1 preferentially binds to the constitutive heterochromatin of centromeres
and telomeres, it has also been observed binding to euchromatic regions (Fanti et al.,
2003). It has been identified in organisms ranging from yeast to humans and was found
to be a highly conserved protein (Wang et al., 2000) that interacts with many other
proteins (Essenberg and Elgin, 2000), suggesting an essential role in genome
organization and function. Accordingly, HP1 was initially described as a
heterochromatin assembly and maintenance protein, but different lines of evidence have
recently established its high versatility and involvement in a wide range of processes
such as nuclear assembly, chromatin organization, activation of replication origins,
DNA replication timing, chromosome segregation, telomere maintenance, DNA damage
response, and DNA repair or gene expression modulation (Eissenberg and Elgin, 2000;
Fanti et al., 2008; Dinant and Luijsterburg, 2009; Vermaak and Malik, 2009; Hayashi et
al., 2009; Schwaiger et al., 2010). At the chromosomal level, HP1 plays a significant
role due to its crucial involvement in chromatid cohesion, chromosome segregation, and
the protection of chromosome integrity during cell division (Nonaka et al., 2002; Fanti
et al., 1998), the latter ensuring cell cycle progression (De Lucia et al., 2005).
Besides its association with heterochromatic and euchromatic domains, HP1 is
required for telomere function by preserving its stability (Fanti and Pimpinelli, 2008).
Hence, HP1 mutations in Drosophila are associated with telomeric fusions,
chromosome breakage and elimination, and abnormal cell division (Kellum et al.,
1995). Loss-of-function HP1 mutants have been reported to have impaired development
132
HP1 knockdown affects both eucromatin and heterochromatin
or embryo lethality. For instance, Aucott et al. (2008) disrupted the murine Cbx1 gene
for HP1- protein in mice and reported perinatal lethality due to defective development
of the cerebral neocortex and the neuromuscular junctions. Likewise, in Caenorhabditis
elegans, double hpl-1/hpl-2 mutants showed larval lethality (Schott et al., 2006) and, in
D. melanogaster, HP1 depletion has a sex dependent deleterious effect leading to
lethality in male flies (Liu et al., 2005).
Most species possess multiple HP1 isoforms that differ in their genome
distribution and functionalities. For instance, mammals and D. melanogaster have three
main different isoforms (HP1α, HP1β and HP1γ, and HP1a, HP1b and HP1c,
respectively), whereas in C. elegans there are only two isoforms (HPL-1 and HPL-2).
Drosophila HP1a and HP1b (and mammalian HP1α and β) bind to heterochromatin and
both heterochromatin and euchromatin, respectively, whereas HP1c (and HP1γ)
localizes exclusively in euchromatin and telomeres (Motamedi et al., 2008; Canudas et
al., 2011). However, this chromatin specificity does not seem to be strict, as distinct
isoforms have been found to bind to the same chromatin domain but at different
moments of the cell cycle (Hayakawa et al., 2003). Although HP1 is mainly known as a
key component of heterochromatin where it promotes gene silencing, this protein seems
more versatile as it also modulates euchromatic and heterocromatic genes, up-down
regulating their transcriptional activities (for review, see Vermaak and Malik, 2009). In
fact, in euchromatic genes, HP1 mainly acts as a positive regulator (Piacentini et al.,
2009; Kwon and Workman, 2011). Due to this multifunctionality, HP1 depletion or loss
of function affects a large set of genes, including those for ribosomal RNA (rRNA)
(Horáková et al., 2010; Larson et al., 2012), the budding uninhibited by benzimidazoles
1 (Bub1) (De Lucia et al., 2005) and the 70 kilodatons heat shock protein (Hsp70)
(Kwon and Workman 2011).
rRNA genes are located at specific chromosome sites named nucleolus
organizing regions (NORs), which contain the ribosomal DNA (rDNA). The phenotype
resulting from the expression of these genes is the nucleolus, which can be revealed
cytologically at interphase and first meiotic prophase by means of the silver
impregnation technique (Rufas et al., 1982). Bub1 (budding uninhibited by
benzimidazole kinase protein) codes a component of the spindle assembly checkpoint
(SAC) whose mutations cause chromatin bridges extending between the separating
groups of chromosomes and an extensive chromosome fragmentation in anaphase cells
(Basu et al., 1999). Depletion of BUB1 in Schizosaccharomyces pombe resulted in an
increase in the frequency of chromosome mis-segregation, whereas in Saccharomyces
cerevisiae the result was higher chromosome loss accompanied by slower growth
(Bernard et al., 1998; Warren et al., 2002). Furthermore, germline mutations that reduce
the amount of BUBR1 (found in higher eukaryotes) produce aneuploidy, shorten
lifespan, and cause cancer and premature aging phenotypes in both mice and humans
(Baker et al., 2013). It has been reported that this gene is down-regulated in the absence
of HP1 (De Lucia et al., 2005). The same occurs with the Hsp70 gene, where Kwon and
Workman (2011) reported that reduced dosage of HP1α caused lower levels of heat
shock mRNA. Experiments performed in D. melanogaster showed that after a heat
133
shock, mutant larvae that lack HP1 showed lower Hsp70 transcription levels compared
with wild-type larvae (Piacentini et al., 2003).
Heterochromatin is the main component of a kind of additional dispensable
chromosome, called supernumerary or B chromosome, which forms part of the genomes
of many eukaryotic species (for review, see Camacho 2005). The heterochromatic
nature of these chromosomes has led to considered them genetically inert for a long
time (Ishak et al., 1991, Stitou et al. 2000, Baroni et al., 2009, Poletto et al., 2010), but
some evidences of B-NOR activity (Bidau et al. 1986, Boeskorov et al. 1995) and
molecular B-transcripts detection (Leach et al., 2005, van Vugt et al., 2005, Carchilan et
al., 2009, Ruiz-Estévez et al., 2012; Banaei-Moghaddam et al., 2013) have recently
been reported.
Eyprepocnemis plorans is a paradigm model for studies on supernumerary
chromosomes. This grasshopper species has a standard (A) genome composed of 22
autosomes plus X0/XX sex chromosomes, with constitutive heterochromatin mostly
located in the vicinity of centromeric regions (Camacho et al., 1991). As in other
grasshoppers, the ninth autosome pair in order of decreasing size (S9) behaves as the
typical heteropycnotic megameric bivalent during meiosis (Corey, 1938). Although
extensive variation for B chromosomes has been reported in this species (see
Henriquez-Gil et al., 1984, López-León et al., 1993, Bakkali et al., 1999), all B variants
were heterochromatic and mainly composed of two kinds of repetitive DNA sequences:
a 180 bp tandem repeat DNA (satDNA) and 45S rDNA (Cabrero et al., 1999). Prior to
the observation of a nucleolus attached to a B chromosome fused to the longest
autosome in E. plorans (Cabrero et al., 1987), the supernumerary chromosomes in this
species were perceived as junk and devoid of genes. The presence of rDNA (LópezLeón et al., 1994) and the cytological absence of nucleoli attached to B chromosomes
(López-León et al., 1995) indicated the silenced nature of these B chromosomes.
However, recurrent expression of B chromosome rDNA (B-rDNA) has recently been
shown in a Spanish population (Teruel et al., 2007, 2009; Ruiz-Estévez et al., 2012).
Furthermore, a recent study of a wide range of Spanish populations has revealed a
residual expression level of B-rDNA in most Spanish populations (Ruiz-Estévez et al.,
2013). With these precedents, E.plorans provides an exceptional arena to study the
consequences of HP1 knockdown, since effects can be differentially assessed at the
level of euchromatin, constitutive heterochromatin (pericentromeric regions of all A
chromosomes and B chromosomes) and facultative heterochromatin (the S9 autosome
and the X chromosome) genomic regions. Furthermore, the three above mentioned
genes, which could putatively be affected by HP1 knockdown, are worth analyzing in E.
plorans because: 1) rRNA genes reside in constitutive heterochromatin in both A and B
chromosomes, 2) Bub1 is related with cell division, and its changes in expression level
could differentially affect the different kinds of chromatin in E.plorans, and 3) the
amount of HSP70 protein decreases in individuals carrying B chromosomes (Teruel et
al., 2011).
In the present work, we explore the effect of HP1 knockdown in E. plorans at
the cytological and molecular levels. Our cytological results suggest that all kinds of
134
HP1 knockdown affects both eucromatin and heterochromatin
chromatin were affected by the HP1 gene knockdown, with general chromatin
decondensation in meiotic cells following a characteristic chromatin-type depending
sequence of events. In addition, HP1 knockdown had opposing effects on the three
genes analyzed, with Bub1 decreasing in gene activity but rRNA and Hsp70 gene
expressions not changing significantly. The overall cytological and physiological effects
of HP1 gene knockdown included the presence of chromosomal bridges, bivalent
decondensation, increased macrospermatid frequency, low number of dividing cells, and
reduced survival.
Materials and methods
Biological samples
We collected 17 males of the grasshopper species E. plorans from a Spanish population
at Jete (Granada, Spain). We chose this population because no nucleolar activity had
previously been observed in the B chromosomes from this population, which makes it a
good material for trying to activate the rDNA in the B chromosome through HP1 gene
knockdown. After anesthesia, a hind leg was taken from each male and the wound was
disinfected with absolute ethanol. After recovery from anesthesia, animals were placed
in culture cages and fed normally to perform the RNAi experiment. The remaining hind
leg and testes of each animal were processed after HP1 gene silencing. We chose hind
leg muscles as the experimental tissue because grasshoppers can loss one of their hind
legs with no effect on viability, and this allowed us to carry out pre- and post-treatment
analyses on the same animals. Legs were frozen in liquid nitrogen and stored at -80ºC
for DNA and RNA extraction and testes were fixed in freshly prepared 1:3 acetic acidethanol and stored at 4ºC for cytological analyses.
Molecular analyses
Nucleic acid isolation and genotyping
Total RNA and genomic DNA (gDNA) were extracted from the hind leg muscle using
the RNeasy Lipid Tissue Mini Kit (Qiagen) and the GenElute Mammalian Genomic
DNA Miniprep Kit (Sigma), respectively. After RNA extraction, the samples were
submitted to a second DNase I treatment (REAL Star Kit, Durviz), to ensure the
absence of contaminating gDNA traces. RNA quantity was measured using
Tecan'sInfinite 200 NanoQuant and its quality assessed in a denaturing agarose gel. For
each sample, 100 ng RNA was retrotranscribed into complementary DNA (cDNA)
using the combination of random and oligo dT primers of the PrimeScript™ RT reagent
-Perfect Real Time- Kit (Takara) and following manufacturer’s recommendations. For
each analysis, a negative control devoid of reverse transcriptase was included to test for
contaminating DNA. The presence of B chromosomes in males was determined by PCR
135
amplification of the B specific SCAR marker in genomic DNA following the protocol
described in Muñoz-Pajares et al. (2011).
HP1 gene amplification, dsRNA synthesis and delivery
The HP1 sequence of E. plorans was identified using tblastn searches of insect HP1α
protein sequences against our local E. plorans transcriptome library. The retrieved DNA
sequences were confirmed using blastx searches against the nr database at the NCBI.
Specific primers to amplify a 194 bp fragment of the E .plorans HP1 gene were
designed using the Fast PCR software (Kalendar et al. 2009). PCR reaction mixture
contained 30 ng cDNA, 200 mM dNTPs, 10 mM each forward (5’
GGCGGCGACGCCCAGTTGGTTTGTTGCTTT
3’)
and
reverse
(5’
CGCGGGCGACCCATCAGGTCTCACATGCAC 3’) primers, and 1 unit of Taq
polymerase (New England, BioLabs) in a final volume of 25 µl. The PCR was
performed in an Eppendorf Mastercycler ep gradient S (Eppendorf) thermocycler using
the following conditions: initial denaturation for 5 min at 94ºC, 30 cycles of 15 s at
94ºC, 15 s at 60ºC and 15 s at 72ºC, followed by a final extension of 5 min at 72ºC.
PCR products were visualized in a 1.5% agarose gel, cleaned with Gen EluteTM PCR
Clean-Up Kit (Sigma) and sequenced by Macrogen Inc.
To obtain double stranded RNA (dsRNA), a transcription promoter was inserted
at the ten nucleotides of the 5’ end of each primer (which do not form part of the gene)
and HP1 sense and anti-sense RNA was obtained following the recommended AmbionLifetechnologies T7 RNA polymerase transcription protocol (as in Cabrero et al., 2013).
One week after leg removal, animals were injected with 5 μg dsRNA at the testes level
of the abdomen. Nine males were treated with the dsRNA and the remaining eight were
injected with insect saline solution and used as control. After 11 days from the first
injection (dffi), a second injection was carried out to ensure efficient HP1 knockdown.
HP1 silencing analysis
After the RNAi treatment period, males were anesthetized and their testes and the
remaining hind leg were processed. Testis fixation, gDNA and total RNA extraction
from each leg and cDNA synthesis were carried out as described above, and the
resulting cDNA was diluted in RNase-DNase free water at a 1:10 ratio.
To determine the most stable reference genes for our gene expression analyses, a
geNorm analysis was carried out in order to test the housekeeping genes (HKGs)
suggested in Van Hiel et al. (2009) and in Chapuis et al. (2011). Standard curves were
used to determine the efficiency of each HKG. The expression level of the HP1 gene
was estimated before (pre-injection) and after (post-injection) the RNAi experiment,
both for the dsRNA-injected and control males, using quantitative retrotranscriptionpolymerase chain reaction (qRT-PCR). The reaction mixtures contained 5µl 2X
SensiMixTM SYBR Mastermix (SensiMixTM SYBR Kit, Bioline), 0.7 µM each
136
HP1 knockdown affects both eucromatin and heterochromatin
forward and reverse primer and 5ng cDNA (pre- or post- injection), in a final volume of
15µl. PCR conditions were as follows: an initial denaturation at 95ºC for 10 min, 40
cycles of 94ºC for 30 s, 62ºC for 15 s, 72ºC for 15 s. A final dissociation step was
always added at the end of each qRT-PCR experiment to identify the unique and
specific amplification of the target sequence. Reactions were carried out in triplicate in a
Chromo4 Real Time PCR thermocycler (BioRad) and, for each run, we included a
negative control without cDNA to ensure that the reagents were free of contaminating
DNA. The data were exported using the Opticon Monitor v3.1 software (Biorad) and
Relative Quantification (RQ) values from the different transcripts were obtained
following the “Efficiency calibrated mathematical method for the relative expression
ratio in real-time PCR” (Roche Applied Science, Technical Note No. LC 13/2001).
Analysis of rDNA, Bub1 and Hsp70 genes expression patterns after HP1 knockdown
qRT-PCR was also performed to estimate the expression levels of the rRNA, Bub1 and
Hsp70 genes from pre- and post-injection male samples. The primers used for
amplifying Bub1 (forward: 5’ CGATGGTTTAGGAGGGTGAA 3’; reverse: 5’
GGCTGAAAATGACCCTGAAA
3’)
and
Hsp70
(forward:
5’GTGTTGGTGGGTGGGTCAACTCG
3’;
reverse:
5’
ACGTCAAGCAGCAGCAGGTCC 3’) were designed using the Primer3 software. For
the rDNA, we amplified the ITS2 sequence by means of two different primer pairs: 1)
those anchoring in the differential region of the ITS2 (forward: 5’
ACTTGGGAGCGTCGTGGTA 3’; reverse: 5’ CGTTGTACGAAAGAGTTTGAG 3’)
which yield an amplicon specific to the B chromosome (qITS2_B) and it is a part of the
ITS2_B (Ruiz-Estévez et al., 2012); 2) the ITS3-4 primers anchored in the 5’8S and 28S
rRNA
genes
(forward:
5’GCATCGATGAAGAACGCAGC
3’;
reverse:
5’ATATGCTTAAATTCAGCGGG 3’). With the first primer pair we could assess
changes in the expression of the rDNA in the B chromosomes, and with the second pair
we could detect general changes for rRNA gene expression in all (A and B)
chromosomes. The HKGs, reaction mixtures and conditions were the same as above,
with the exception of the annealing step: 60ºC for ITS3-4, Bub1 and Hsp70, and 73.5ºC
for qITS2_B.
Cytological techniques
Chromosome analyses were carried out to evaluate the effect of HP1 gene knockdown
on chromatin organization, chromosomal behaviour and NOR expression. Meiotic
preparations were obtained from testis follicles as described in Cabrero et al., (1999).
Chromosome preparations were analyzed using a BX41 Olympus epifluorescence
microscope and cell images were taken using a DP70 digital camera. Images were
composed and optimized for bright and contrast with The Gimp freeware.
137
Silver Stain
To visualize the nucleoli and measure their areas in diplotene and zygotene cells,
respectively, we silver stained meiotic preparations of testis follicles from males at 1728 days from the first injection (dffi). For this purpose, we used the method described in
Rufas et al. (1982) and, to differentiate the nucleoli (brown) from the chromatin (blue),
a final 5% Giemsa staining step was performed. To search for anomalies in nucleoli
appearance and to check whether the B chromosome showed any NOR activity we
analyzed 20 diplotene cells from the control males and all the available cells from the
experimental males. In addition, the total nucleolus area per cell was measured and
analyzed in 20 zygotene cells from experimental and control males using the ImageJ
software (Schneider et al., 2012) and the GPL3 licensed Python pyFIA software (RuizRuano et al., 2011).
C-Banding
This technique was performed on chromosome preparations from males at 21-30 dffi,
following the protocol described in Camacho et al. (1991), with the following slight
modifications: Ba(OH)2 for 3.5 min and 5% Giemsa. This assay was performed in
order to analyze possible effects of HP1 knockdown on heterochromatin organization
and chromosome behaviour during meiosis. We also scored 200 spermatids, classifying
them into three groups: normal, micro- and macrospermatids. We also scored the
frequency of abnormal meiotic cells in preparations submitted to these two last
techniques.
Fluorescent in situ hybridization (FISH)
Meiotic cells were permeabilized by submitting preparations to 100 µl of 50 μg/ml
pepsine in 0.01 N HCl for 10 min at 37ºC. After three vigorous washes in distilled
water, slides were dehydrated through a series of 70%, 90% and 100% ethanol for 3, 3
and 5 min, respectively, and they were stored at 60ºC overnight. RNase treatment,
paraformaldehyde fixation and FISH assay were performed as described in Cabrero et
al. (2003). We used fluorescein-labelled (GGTTA)7 and (TAACC)7 synthetic
deoxyoligomers as telomeric probes (Meyne et al., 1995).
Immunofluorescence analysis
Fixation of testis follicles and squash preparations were performed as described in
Cabrero et al. (2007a). Immunofluorescence analysis of the Ku70 protein was
performed following the methods described in Cabrero et al. (2007b; 2013), using H308 (Santa Cruz Biotechnology Inc., CA, USA), a rabbit antibody rose against
aminoacids 302-609 of the human Ku70.
138
HP1 knockdown affects both eucromatin and heterochromatin
Statistical Analyses
Normality of all variable distributions was tested by the Shapiro-Wilk test, and
parametric Student t tests were used for those fitting a normal distribution, whereas nonparametric (Mann-Whitney and contingency chi square) tests were used for those
variables failing to show a normal distribution. All tests were performed using the
STATISTICA 8.0 software (StatSoft, Inc. 2007) (www.statsoft.com).
Results
HP1 knockdown was effective in RNAi males
PCR analysis using the B-specific SCAR primers showed the presence of seven Bcarrying and one B-lacking (no. 4) males in the control group, and eight B-carrying and
one B-lacking (no. 29) males in the dsRNA injected group. PCR amplification of HP1
in the 17 males yielded a 194 bp fragment which was sequenced and tested by
alignment to the E. plorans HP1α sequence from our transcriptome library. The
alignment confirmed that the 194 bp fragment was part of the HP1α gene (Fig. S1).
Seven days after the first injection (dffi), RNAs from three experimental and
three control males were analyzed by qRT-PCR using RP49 and Armadillo as HKGs.
The average post-/pre-injection ratio of HP1 expression was 1.16 in the control males
and 0.87 in the experimental ones (Table 1), but this difference was not significant
(Mann-Whitney U test; U=4. Z= -0.22. P= 0.83). For this reason, we performed a
second injection to the 11 remaining males at 11 dffi.
Table 1. Levels of HP1 transcript at 7 days from first injection (dffi). Control=
control males; Exp= experimental males; SE= Standard Error.
PrePostMean
Male type
Male no. injection injection Post-/Pre(SE)
13
1.05
1.03
0.98
Control
2
3.64
1.02
0.28
1.16 (0.67)
24
0.6
1.33
2.23
20
0.53
0.69
1.32
Exp
30
3.41
1.48
0.43
0.87 (0.25)
6
0.68
0.57
0.84
After this second injection, the remaining males became weaker as the days
passed. To avoid loss of material, the weakened males were processed once they
showed symptoms of possible death. Only two out of the 11 males (no. 12 and 14) did
not show the former symptoms. Table 2 shows the dffi at which these 11 males were
processed and their pre- and post-dsRNA injection levels of HP1 expression. In this
139
case, a significant decrease in HP1 transcription level was detected in experimental
males in respect to the control ones (Mann-Whitney test; Z=-2.56, P= 0.01) (Fig. 1).
Table 2. Post-/pre-injection ratio of HP1 transcript levels and dffi in which the 11
double injected males were processed. Control= control males; Exp= experimental
males; Dffi= days from the first injection; SE= Standard Error.
PostPre/PreMean
Male type Male no.
Dffi
injection Post-injection
ratio
(SE)
5
21
0.70
0.17
0.24
Control
8
21
1.46
0.10
0.07
4
25
0.39
0.17
0.44
0.5 (0.22)
25
27
0.25
0.14
0.58
18
28
0.24
0.28
1.16
29
17
0.38
0.07
0.18
Exp
15
21
0.52
0.03
0.06
14
21
0.29
0.01
0.04
0.06
(0.03)
11
24
0.55
0.02
0.03
3
25
0.74
0.02
0.03
12
28
0.29
0.01
0.04
Fig. 1 Levels of HP1 transcripts in control and experimental (exp) males after one (1) or
two (2) injections and analyzed at 7 or 17-28 dffi, respectively. Bars represent Standard
Error (SE).
140
HP1 knockdown affects both eucromatin and heterochromatin
Influence of HP1 knockdown on the activity of other genes
We analyzed the pre- and post-injection expression levels of three of the genes reported
elsewhere as putatively depending on HP1, i.e. rRNA, Bub1 and Hsp70. As Table 3 shows,
Bub1 showed a significant decrease in expression in HP1 RNAi treated animals, but no
significant effect was noticed for the two other genes.
Table 3. ITS3-4, qITS2_B, Bub1 and Hsp70 Post-/Pre-injection transcription levels in
control and experimental males where the HP1 was knocked down. Control= control
males; Exp= experimental males; Dffi= days from the first injection; SE= Standard
Error.
Male
ITS3-4
qITS2_B
Bub1 Post- Hsp70 PostMale type no.
Dffi Post-/Pre- Post-/Pre/Pre/PreControl
5
21
0.62
0,00
0.76
6.29
8
21
0.82
0.38
0.52
1.04
4
25
1.74
4.77
0.53
0.68
25
27
0.45
2.28
1.24
0.19
18
28
2.18
3.42
0.61
0.73
1.16
2.17
0.73
1.79
Mean
0.34
0.90
0.13
1.13
SE
Exp
29
17
1.17
0.29
0.45
0.55
15
21
1.55
0.81
0.91
1.17
14
21
0.71
0
0.4
0.35
11
24
1.09
0.16
0.46
1.24
3
25
1.08
0.45
0.5
0.64
12
28
1.93
4.8
0.39
0.72
1.26
1.09
0.52
0.78
Mean
0.17
0.75
0.08
0.14
SE
Z-value
0.55
0.73
2.01
0.37
P-value
0.58
0.47
0.04
0.72
To test for the possible association between HP1 and the large centromeric KU70
foci observed in metaphase and anaphase cells of E. plorans, which was speculated about
in Cabrero et al. (2013), immunofluorescence with the anti-KU70 antibody used by these
authors was performed to detect the presence of KU70 at the centromeres of HP1
knockdown males. Fig. S2 shows how HP1 knockdown did not abolish KU70 association
with the centromeric regions of the E. plorans chromosomes. Our results thus suggest the
absence of a centromere-related functional relationship between these two proteins.
Physiological effects of HP1 knockdown
HP1 knockdown was associated with a succession of four remarkable physiological and
phenotypic effects: i) An initial extreme decay of activity, so that males were unable to
141
jump after mechanical stimulus, ii) signs of imminent death, suggesting that HP1 is a
vital protein in E. plorans, iii) once sacrificed, experimental males showed
conspicuously smaller muscle mass in the leg and much less hemolymph, compared to
the pre-injection leg, and also to control males and, iv) they also had fewer dividing
cells in the testes compared to control males.
Cytological effects of HP1 knockdown
Overall, a lower proportion of dividing cells was observed in experimental males with
respect to control males, which suggests an effect of HP1 knockdown on cell cycle
progression.
For the silver stain analysis, we obtained 18 diplotene cells from the male no. 29,
20 cells from no. 15, 11 from no. 14, 5 from no. 11, 3 from no. 13, none from no. 3, and
20 from each control male. While apparently normal nucleoli were associated with the
autosomes S9 , S10 and S11 and the X chromosome, no nucleolus was attached to the B
chromosomes either in experimental or control males (Fig. 2 a, b), which suggests the
inactivity of the rDNA of B chromosomes irrespectively of HP1 expression level.
Fig. 2 Normal (a) and abnormal (b-i) spermatocytes from experimental HP1 knockdown
males. Three types of abnormal cells were observed: i) cells with only the S9 bivalent
less condensed (b, c), ii) cells showing a progressive disruption of all chromatin types
condensation (d-f) and iii) cells showing chromatin bridges between chromosomes (g-i).
Arrows in b and c show the poorly condensed S9 bivalent. Bars are equivalent to the X
chromosome size (5µm). SS= Silver Stain, CB= C-Banding, X= X chromosome, B= B
chromosome.
142
HP1 knockdown affects both eucromatin and heterochromatin
Furthermore, the total area of the nucleoli analyzed in zygotene cells indicated
that there was no significant difference between experimental and control males (t-test=
0.27, df= 9, P= 0.79) (Table 4), suggesting that HP1 knockdown had no direct
implications on the total nucleolar area per cell.
Table 4. Mean total cell nucleolus area in control and HP1
knocked down RNAi males. The analysis was carried out in 20
zygotene cells per male. Control= control males; Exp=
experimental males; Dffi= days from the first injection; px=
pixel; SE= Standard Error.
Mean of total nucleoli area
Male type
Male no.
Dffi
per cell (px)
Control
5
21
15248.80
8
21
13315.15
4
25
9008.15
25
27
13142.90
18
28
14691.50
13081.30
Mean
1094.07
SE
Exp
29
17
7691.30
15
21
17608.40
14
21
16141.00
11
24
10662.80
3
25
14104.05
12
28
15436.88
13607.40
Mean
1524.16
SE
t-value
0.27
P-value
0.79
After C-banding, the normal pattern of C-bands on the pericentromeric region of
all A chromosomes and on the whole B chromosomes (Fig. 2c) was observed in 100%
of the cells from the control males, but only in 24.3% of cells from the experimental
males. In the latter case, we recorded three types of abnormal cells (Table 5): i) 7.3% of
the diplotene cells showed the S9 bivalent less condensed than the other bivalents, thus
losing its megameric condition (Fig. 2 b,c), ii) 8.6% of the cells showed generalized
abnormal chromatin condensation affecting the facultatively heterochromatic A
chromosomes (i.e. the X and megameric S9 chromosomes) and the constitutively
heterochromatic pericentromeric regions (reduced to small C-bands) and the B
chromosome (Fig. 2d-f), and iii) 59.8% of the cells showed chromatin bridges between
chromosomes (Fig. 2g-i).
143
Table 5. Percentage of the different types of meiotic cells found in the experimental
males. Dffi= days from the first injection; N= number of analyzed cells; SE= Standard
Error; abnormal cell type I= S9 bivalent less condensed; abnormal cell type II=
generalized abnormal chromosome condensation; abnormal cells type III=
chromosomes with chromatin bridges.
%
%
%
%
Male
abnormal abnormal
Dffi
N
normal
abnormal
no.
cells type
cells type
cells
cells type I
II
III
29
17
195
25.83
9.03
4.58
60.56
14
21
199
33.67
5.53
7.04
53.77
15
21
206
23.79
12.62
2.91
60.68
11
24
74
15.69
3.27
2.61
78.43
3
25
153
32.89
11.84
9.21
46.05
12
28
174
13.79
1.72
25.29
59.2
Mean (SE) 166.8 (20.2) 24.3 (3.4)
7.3 (1.8)
8.6 (3.5)
59.8 (4.4)
A score of about 200 spermatids per male in four experimental and four control
males (Table 6) showed that the frequency of macrospermatids (Fig. 3) was higher in
experimental males (contingency χ2= 11.73, df= 1, P= 0.0006), but no significant
difference was detected for the frequency of microspermatids (χ2= 0.19, df= 1, P=
0.6643).
Table 6. Number of macro-, micro-, and normal spermatids in
control and experimental HP1 knockdown males.
Control Experimental
Total
45
90
135
Macrospermatids
6
8
14
Microspermatids
756
797
1553
Normal spermatids
Fig. 3 The three types of
spermatids found in the
experimental and control
males: Macrospermatids
(M), microspermatids (m)
and normal spermatids (n).
144
HP1 knockdown affects both eucromatin and heterochromatin
The FISH analysis performed with the telomeric probe in both experimental and
control males resulted in a similar pattern, with telomeric signals in the two
chromosome ends, even when chromosome bridges were formed (Fig. S3). Although,
we can not discard that a slight and not detectable telomeric sequence loss could have
occurred in the HP1 knockdown males, we can conclude that telomeric DNA sequences
remain in the chromosomes of the cytologically abnormal cells observed.
Discussion
The HP1α knockdown performed through RNAi, based on dsRNA, led to a statistically
significant reduction of HP1 transcript levels and also resulted in a significant reduction
in Bub1 gene expression, loss of chromosome integrity, abnormal chromatin
condensation, and some remarkable phenotypic and physiological effects. However, no
changes for rRNA and Hsp70 gene expressions were observed. Our results are
consistent with the Bub1 gene downregulation observed in the absence of HP1 by De
Lucia et al., (2005) in Drosophila, and support the essential role of these two genes in
chromosome behaviour and integrity (Fanti et al., 1998; Basu et al., 1999). Accordingly,
75.7% of the meiotic cells in dsRNA treated individuals were aberrant (see Table 5),
with phenotypes including less condensation of the S9 bivalent alone or else of all
chromosomes, and the presence of chromatin bridges between chromosomes.
HP1 knockdown individuals showed an unique altered pattern of chromosome
condensation, with 7.3% of the diplotene cells showing abnormal low condensation of
the megameric S9 bivalent alone, and an additional 8.6% of cells showing a disruption
of normal chromatin condensation of all the chromosomes, including the S9
(megameric), the X and the B chromosomes, which in normal cells are positively
heteropycnotic. This result implies an effect of HP1 knockdown on the condensation
level of different chromatin types which is first noted at the facultative heterochromatin
of the S9, (see Fig 2b, c), then at the euchromatin of all the chromosomes (see Fig. 2d),
followed by the facultative heterochromatin of the sex chromosome and most of the
constitutive heterochromatin of A (pericentromeric regions) (see Fig. 2e) and B
chromosomes (see Fig. 2f). Hence, abnormal cells showed less condensed S 9 bivalents,
reduced pericentromeric C bands and unidentifiable X and B chromosomes due to poor
level of chromatin condensation and lack of positive heteropycnosis. In consistency
with these results, HP1 knockdown causes decondensation of the X chromosome in
Drosophila males (Spierer et al., 2005). There was, however, a small pericentromeric
region which was highly condensed in both normal and abnormal cells, presumably due
to centromeric proteins protection.
The observed chromatin-type dependent pattern of abnormal condensation of the
chromosomes in HP1 knockdown E. plorans further demonstrates that HP1 has effects
that go beyond the heterochromatin and broadens the well known role of HP1 in
chromatin assembly (Eissenberg and Elgin, 2000). The interruption of chromatin
145
condensation during meiotic prophase I might account for the effects induced by HP1
knockdown in E. plorans. Alternatively, a failure in the maintenance of the condensed
state of chromatin leading to chromosome decondensation, could not be ruled out, but
the ultimate molecular regulatory mechanisms remain to be unveiled.
It has been shown that chromosome bridges can result from telomere-telomere
fusions produced by HP1 inactivation (Fanti et al., 1998) and the missregulation in the
expression of telomere-related genes as Bub1(Basu et al 1999). The molecular basis for
the chromosome bridges in E. plorans does not seem to be related with a complete loss
of telomeric DNA sequences, given that FISH experiments showed the presence of
telomeric sequences in the experimental male chromosomes (see Fig. S3). Alternatively,
this abnormal chromosome behaviour might also be the consequence of an impaired
HP1-telomere interaction due to HP1 knockdown. Indeed, it is known that HP1 is an
important structural component of the centromere and telomere heterochromatin and is
involved in the control of telomere elongation and behaviour, interfering with hTERTTelomere interactions (Fanti et al., 1998; Savitsky et al., 2002; Sharma et al., 2003).
The observation of aberrant chromosome configurations during cell division
allows predicting possible failures in chromosome segregation leading to impaired
cytokinesis and the subsequent production of polyploidy cells. Indeed, bridges between
all non-homologous chromosomes (see Fig. 2) were frequently observed, suggesting
generalized missegregation and cytokinesis arrest. This might explain the significant
increase in the frequency of macrospermatids observed in HP1 knockdown males as
compared to control ones. Segregation failure of specific chromosomes is not likely to
occur in this case because this would predict an increase in the frequency of
microspermatids, but it was not observed.
In contrast to the repressive effect of HP1 knockdown on the Bub1 gene, which
is in agreement with the results reported by De Lucia et al. (2005) in Drosophila, we did
not observe any effect of HP1 knockdown either on rRNA or on Hsp70 genes
transcriptional level. HP1 plays a role in the transcriptional regulation of rRNA genes in
some species, and our result is in agreement with the species-dependent effects that
have been previously observed. For instance, in mice, HP1β colocalizes with RNA pol I
and modulates transcriptional activity of rRNA genes, so that reduced levels of HP1β
are correlated with reduced levels of the large subunit of the RNA pol I (Horáková et
al., 2010). In Drosophila, however, HP1 has a predominantly repressive role on rRNA
gene activity, so that HP1 loss leads to a transcriptional enhancement of these genes
(Larson et al., 2012). In E. plorans, qRT-PCR amplification revealed no effect of the
HP1α knockdown, neither on the ITS3-4 or the ITS2-B transcripts levels (see Table 3).
Accordingly, we neither observed significant changes in NOR expression at the S 9, S10,
S11 and X chromosomes of the silver stained diplotene cells. B chromosomes also
lacked NOR activity in both RNAi and control males, as previously reported in this
population (López-León et al., 1995), suggesting that the rDNA in the B chromosomes
is inactive due to other reasons than HP1 knockdown. In addition, the mean of total cell
nucleolus area, a parameter found to be related with the level of rRNA gene expression
146
HP1 knockdown affects both eucromatin and heterochromatin
(for review, see Teruel et al., 2007), did not differ between RNAi and control males (see
Table 4). These results indicate that HP1 knockdown in E. plorans did not influence
rRNA gene expression. A possible explanation is that a putative increase in transcription
level of these genes in injected males could have been counteracted by an opposite
downregulation effect derived from the aging symptoms induced by HP1 depletion.
Perhaps the NOR activity increase could have derived from decrease in heterochromatin
amount (Larson et al., 2012). Alternatively, the apparent absence of effect of HP1
knockdown on rRNA gene activity could have something to do with the so-called
“chromatin states of rRNA genes” (Lucchini and Sogo, 1998; Hamperl et al., 2013),
since constitutive heterochromatin, where these genes are immersed in E. plorans,
appears to be the last chromatin compartment to be affected in RNAi males. Whatever
the case, our results is a further prove that the effect of HP1 knockdown may be
different depending on the HP1 variant and/or the species considered (Serrano et al.,
2009; Lee et al., 2013).
Our experiments also failed to detect any effect of HP1 knockdown on the
expression of the Hsp70 gene. This result apparently contradicts the decrease in Hsp70
mRNA associated with reduced levels of HP1 and the enhancing effect that HP1
overexpression has on Hsp70 gene expression (Piacentini et al., 2003). Yet our result
might also be another proof in favour of the gene and species dependent roles of HP1.
The lack of effect of HP1 knockdown on the activity of two out of the three
genes analyzed in this work might be puzzling, especially since they were reported to
interact with HP1 in other species. However, with HP1 having potentially speciesdependent effects, it is conceivable that, in E. plorans, any real interaction between HP1
and these two genes might be shadowed by the effect of HP1 knockdown on other genes
that also interact with rRNA and Hsp70 genes (for instance if HP1 knockdown downregulates a gene at the same time as it up-regulates its activator, and vice versa). Such
possibility is especially plausible for genes that have a wide range of gene interactions
so that impairment of their activity results in a global maladjustment of many genes
activity. A DNA microarray profiling of differentially regulated genes for the three
different HP1 variants present in Drosophila suggests that HP1 is indeed a wide-range
acting protein (see Lee et al., 2013). This would also explain the potentially speciesdependent effect of the HP1 knockdown on gene activity, since the effect of the wideacting HP1 knockdown on a gene would depend on the entire network of affected genes
and on the position and interactions of that gene within its network which is also
species-dependent.
Although HP1 is generally considered a heterochromatin marker protein, it can
affect both heterocromatin and euchromatin gene expression, producing both global and
gene specific effects (for review, see Vermaak and Malik, 2009). Accordingly, the HP1
dsRNA-knockdown performed in E. plorans males caused major phenotypic and
physiological effects on treated individuals decreasing their mobility and vitality (as
reflected by their lethargy and inability to jump in response to mechanical stimulus),
muscle mass, hemolymph amount, cell divisions and survival. These are all phenotypic
147
signs that fit a scenario of gradual debilitation that ultimately leads to death. Lethality
related to HP1 inactivation has been reported in Drosophila melanogaster at larval
stages, so that individuals with a 90% reduction of HP1α rarely reach the adult stage
(Liu et al., 2005). Nonetheless, similar effect on survival has not been found in
Caenorhabditits elegans where HLP-1 and HLP-2 deficient nematodes are viable
(Studencka et al., 2012).
A deleterious effect of HP1 knockdown in E. plorans could be produced by loss
or impairment of heterochromatin formation. In fact, a relationship between HP1α and
myogenic gene expression in myoblasts has been observed in mice in such a way that its
depletion produces anomalous skeleton muscle differentiation (Sdek et al., 2013).
Moreover, Larson et al., (2012) pointed out that the maintenance of normal level of
heterocromatin in chromosomes is an essential requirement to conserve muscle integrity
and lifespan, and one of the causes of why aged Drosophila individuals die is
sarcopenia (muscle degeneration). This fact has also been observed in C. elegans
(Herndon et al., 2002). Even the premature aging observed in human progeric
syndromes is correlated with loss of heterochromatin (Liu et al., 2011). Modification of
heterochromatin organization might not be the sole cause for the observed deleterious
effect. Changes in euchromatin organization and misregulation of euchromatic genes
might also be contributing. In fact, our results point towards euchromatin
decondensation in HP1 knockdown cells, which further supports that HP1 is a wideinteracting protein that promotes up and down regulation of heterocromatic as well as
euchromatic genes. Furthermore, this protein family is mainly located at centromeric
heterochromatin but its association with euchromatin has also been reported (Piacentini
et al., 2009). In addition, alterations in DNA damage response (Dinant and Luijsterburg,
2009; Luijsterburg et al., 2009) could also be responsible for the deleterious effects
shown by HP1 knockdown in E. plorans individuals.
HP1 is necessary for proper chromosome condensation dynamics, adequate
heterochromatinization and chromosome segregation. We conclude that HP1 is a wide
acting gene whose knockdown, and the consequent reduction of its transcript level,
results in abnormal condensation of almost all chromatin types with the consequent
gene mis-expression, chromosome bridges, cell division anomalies and, ultimately, a
wide range of phenotypic and physiological changes leading to death. The specific
effect observed in a given cell will probably depend on the cell cycle stage at which the
HP1 knockdown takes effect.
Acknowledgements
We thank T. López for technical assistance and Karl Meunier for language revision. This study
was supported by a grant from the Spanish Ministerio de Ciencia e Innovación (CGL200911917) and Plan Andaluz de Investigación (CVI-6649), and was partially performed by FEDER
funds. M Ruíz-Estévez was supported by a FPU fellowship from the Spanish Ministerio de
Ciencia e Innovación. M. Bakkali wishes to thank the Spanish Ministerio de Ciencia e
Innovación both for the grant (BFU2010-16438) and for the Ramón y Cajal Fellowship.
148
HP1 knockdown affects both eucromatin and heterochromatin
References
Aucott R, Bullwinkle J, Yu Y et al (2008) HPI- is required for development of cerebral
neocortex and neuromuscular junctions. J Cell Biol 183: 597-606
Baker DJ, Dawlaty MM, Wijshake T et al (2013) Increased expression of BubR1
protects against aneuploidy and cancer and extends healthy lifespan. Nat Cell
Biol 15(1):96-102
Bakkali M, Cabrero J, López-León MD, Perfectti F, Camacho JPM (1999) The B
chromosome polymorphism of the grasshopper Eyprepocnemis plorans in
North Africa I. B variants and frequency. Heredity 83:428-434
Banaei-Moghaddam AM, Meier K, Karimi-Ashtiyani R, Houben A (2013) Formation
and expression of pseudogenes on the B chromosome of rye. The Plant Cell,
Vol. 25: 2536–2544
Baroni S, Lopes CE, de Almeida-Toledo LF (2009) Cytogenetic characterization of
Metynnis maculatus (Teleostei; Characiformes): the description in Serrasalminae
of a small B chromosome bearing inactive NOR-like sequences. Caryologia
62:95–101
Basu J, Bousbaa H, Logarinho E et al (1999) Mutations in the essential splindle
checkpoint gene Bub1 cause chromosome missegregation and fail to block
apoptosis in Drosophila. J Cell Biol 146(1):13-28
Bernard P (1998) Fission yeast bub1 is a mitotic centromere protein essential for the
spindle checkpoint and the preservation of correct ploidy through mitosis. J Cell
Biol 143:1775–1787
Bidau CJ (1986) A nucleolar-organizing B chromosome showing segregation-distortion
in the grasshopper Dichroplus pratensis (Melanoplinae, Acrididae). Can J
Genet Cytol 28:138–148
Boeskorov GG, Kartavtseva IV, Zagorodniuk IV, Belianin AN, Liapunova EA (1995)
Nucleolus organizer regions and B-423 chromosomes of field mice (Mammalia,
Rodentia, Apodemus). Genetika 31(2):185-192
Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the
grasshopper Eyprepocnemis plorans on nucleolar organizer regions activity.
Activation of a latent NOR on a B chromosome fused to an autosome. Genome
29:116–121
Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999) Common origin of B
chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity
83:435-439
Cabrero J, Bugrov A, Warchalowska-Sliwa E, López-León MD, Perfectti F, Camacho
JPM (2003) Comparative FISH analysis in five species of Eyprepocnemidine
grasshoppers. Heredity 90:377-381
Cabrero J, Teruel M, Carmona FD, Camacho JPM (2007a) Histone H2AX
phosphorylation is associated with most meiotic events in grasshopper.
Cytogenet Genome Res 116:311-315.
Cabrero J, Palomino-Morales RJ, Camacho JPM (2007b) The DNA-repair Ku70 protein
is located in the nucleus and tail of elongating spermatids in grasshoppers.
Chromosome Res 15:1093-1100
Cabrero J, Bakkali M, Navarro-Dominguez B et al (2013) The Ku70 DNA-repair
protein is involved in centromere function in a grasshopper species.
Chromosome Res 21: 393-406
149
Camacho JPM, Cabrero J, Viseras E, López-León MD, Navas-Castillo J, Alché JD
(1991) G-banding in two species of grasshoppers and its relationship to C, N
and fluorescence banding techniques. Genome 34:638-643. doi:10.1139/g91097
Camacho JPM (2005) B chromosomes. In: Gregory TR, ed. The evolution of the
genome. New York: Academic Press. pp 223–286
Canudas S, Houghtaling BR, Bhanot M et al (2011) A role for heterochromatin protein
1 at human telomeres. Genes and Development 25:1807-1819
Carchilan M, Kumke K, Mikolajewski S, Houben A (2009) Rye B chromosomes are
weakly transcribed and might alter the transcriptional activity of A chromosome
sequences. Chromosoma 118:607–616
Chapuis MP, Tohidi-Esfahani D, Dodgson T et al (2011) Assessment and validation of
a suite of reverse transcription-quantitative PCR reference genes for analyses of
density-dependent behavioural plasticity in the Australian plague locust BMC
Mol Biol 12:7
Corey HI (1938) Heteropycnotic elements of orthopteran chromosomes. Arch Biol
49:159-172
De Lucia F, Ni JQ, Vaillant C, Sun FL (2005) HP1 modulates the transcription of cellcycle regulators in Drosophila melanogaster. Nucleic Acids Res 33(9):28522858
Dinant C and Luijsterburg MS (2009) The emerged role of HP1 in the DNA damage
response. Mol Cell Biol 29(4):6335-6340
Eissenberg JC and Elgin SC (2000) The HP1 protein family: getting a grip on
chromatin. Curr Opin Genet Dev 10:204-210
Fanti L, Giovinazzo G, Berloco M, Pimpinelli S (1998) The heterochromatin protein 1
prevents telomere fusions in Drosophila. Mol Cell 2(5):527-538
Fanti L, Berloco M, Piacentini L, Pimpinelli S (2003) Chromosomal distribution of
heterochromatin protein 1 (HP1) in Drosophila: a cytological map of
euchromatic HP1 binding sites. Genetica 117:135-147
Fanti L and Pimpinelli S (2008) HP1: a functionally multifaceted protein. Curr Opin
Genet Dev 18(2):169-174. doi:10.1016/j.gde.2008.01.009
Hamperl S, Wittner M, Babl V, Perez.Fernandez J, Tschochner H, Griesenbeck J (2013)
Chromatin states at ribosomal DNA loci. Biochimica et Biophysica Acta
1829:405-417
Hayakawa T, Haraguchi T, Masumoto H, Hiraoka Y (2003) Cell cycle behaviour of
human HP1 subtypes: Distinct molecular domains of HP1 are required for the
centromeric localization during interphase and metaphase. J Cell Sci 116:33273338
Hayashi MT, Takahashi TS, Nakagawa T, Nakayama J, Masukata H (2009) The
heterochromatin protein Swi6/HP1 actives replication origins at the
pericentromeric region and silent mating-types locus. Nat Cell Biol 11:357-362
Henriques-Gil N, Santos JL, Arana P (1984) Evolution of a complex polimorphism in
the grasshopper Eyprepocnemis plorans. Chromosoma 89:290-293
Herndon LA, Schmeissner PJ, Dudaronek JM et al (2002) Stochastic and genetic factors
influence tissue-specific decline in ageing C. elegans. Nature 419(6909):808814
Horáková AH, Bártová E, Galiová G, Uhlírová R, Matula P, Kozubek S (2010)
SUV39h-independent association of HP1 beta with fibrillarin-positive nucleolar
regions. Chromosoma 119(3):227-241. doi:10.1007/s00412-009-0252-2
150
HP1 knockdown affects both eucromatin and heterochromatin
Ishak B, Jaafar H, Maetz JL, Rumpler Y (1991) Absence of transcriptional activity of
the B-chromosome of Apodemus peninsulae during pachytene. Chromosoma
100:278–281
James TC and Elgin SC (1986) Identification of a non histone chromosomal protein
associated with heterochromatin in Drosophila melanogaster and its gene. Mol
Cell Biol 6:3862-3872
Kellum R, Raff JW, Alberts BM (1995) Heterochromatin protein 1 distribution during
development and during the cell cycle in Drosophila embryos. Journal of cell
science 108(4):1407-1418
Kwon
SH
and Workman
JL
(2011)
The changing faces of HP1:
From heterochromatin formation and gene silencing to euchromatic gene
expression: HP1 acts as a positive regulator of transcription. Bioessays
33(4):280-289. doi:10.1002/bies.201000138
Larson K, S J Yan, Tsurumi A et al (2012) Heterochromatin formation promotes
longevity and repress ribosomal RNA synthesis. PLoS Genetics 8(1): e1002473.
doi:10.1371/journal.pgen.1002473
Leach CR, Houben A, Bruce F et al (2005) Molecular evidence for transcription of
genes on a B chromosome in Crepis capillaris. Genetics 171:269–278
Lee DH, Li Y, Shin DH et al (2013) DNA microarray profiling of genes differentially
regulated by three heterochromatin protein 1 (HP1) homologs in Drosophila.
Biochem Biophys Res Commun 434(4):820-828
Liu LP, Ni JQ, Shi YD, Oakeley EJ, Sun FL (2005) Sex-specific role of Drosophila
melanogaster HP1 in regulating chromatin structure and gene transcription.
Nature Genetics 37:1361-1366
Liu GH, Barkho BZ, Ruiz S et al (2011) Recapitulation of premature ageing with iPSCs
from Hutchinson-Gilford progeria syndrome. Nature 472(7342):221-5
López-León MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL (1993)
Generating high variability of B chromosomes in Eyprepocnemis plorans
(grasshopper). Heredity 71:352-362
López-León MD, Neves N, Schwarzacher T, Heslop-Harrison JS, Hewitt GM, Camacho
JPM (1994) Possible origin of a B chromosome deduced from its DNA
composition using double FISH technique. Chromosome Res 2: 87-92
López-León MD, Cabrero J, Camacho JPM (1995) Changes in NOR activity pattern in
the presence of supernumerary heterochromatin in the grasshopper
Eyprepocnemis plorans. Genome 38:68-74
Lucchini R and Sogo JM (1998) The Dynamic Structure of Ribosomal RNA Gene
Chromatin. In: M.R. Paule (Ed.), Transcription of Ribosomal RNA Genes by
Eukaryotic RNA Polymerase I, 1st ed., Springer, pp: 255–276
Luijsterburg MS, Dinant C, Lans H et al (2009) Heterochromatin protein 1 is recruited
to various types of DNA damage. J Cell Biol 185(4):577-586
Meyne J, Hirai H, Imai HT (1995) FISH analysis of the telomere sequences of bulldog
ants (Myrmecia: Formidae). Chromosoma 104: 4-18
Motamedi MR, Hong EJ, Li X et al (2008) HP1 proteins form distinct complexes and
mediate heterochromatic gene silencing by nonoverlapping mechanisms. Mol
Cell 32(6):778-790
Muñoz-Pajares J, Martínez-Rodríguez L, Teruel M, Cabrero J, Camacho JPM, Perfectti
F (2011) A single, recent origin of the accessory B chromosome of the
grasshopper Eyprepocnemis plorans. Genetics 187: 853-863
Nonaka N, Kitajima T, Yokobayashi S et al (2002) Recruitment of cohesion to
heterocromatin regions by Swi6/HP1 in fission yeast. Nat Cell Biol 4:89-93
151
Piacentini L, Fanti L, Berlocc M, Perrini B, Pipinelli S (2003). Heterochromatin protein
1 (HP1) is associated with induced gene expression in Drosophila euchromatin.
J Cell Biol 161:707- 714
Piacentini L, Fanti L, Negri R et al (2009) Heterochromatic protein 1 (HP1a) positively
regulates euchromatic gene expression through RNA transcript association and
interaction with hnRNPs in Drosophila. PLoS Genetics 5(10):e1000670.
doi:10.1371/journal.pgen.1000670
Poletto AB, Ferreira IA, Martins C (2010) The B chromosomes of the African cichlid
fish Haplochromis obliquidens harbour 18S rRNA gene copies. BMC Genet
11:1
Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver staining procedure for
the localization of nucleolus and nucleolar organizer under light and electron
microscopy. Arch Biol 93:267–274
Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome
Ribosomal DNA is functional in the grasshopper Eyprepocnemis plorans. PLoS
ONE 7(5): e36600. doi:10.1371/journal.pone.0036600
Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is
active in different B chromosome variants of the grasshopper Eyprepocnemis
plorans. Genetica. doi: 10.1007/s10709-013-9733-6
Ruiz-Ruano FJ, Ruiz-Estévez M, Rodríguez-Pérez J, López Pino JL, Cabrero J,
Camacho JPM (2011) DNA Amount of X and B Chromosomes in the
grasshoppers Eyprepocnemis plorans and Locusta migratoria. Cytogenet
Genome Res 134:120–126
Savitsky M, Kravchuk O, Melnikova L, Georgiev P (2002) Heterochromatin Protein 1
is involved in control telomere elongation in Drosophila melanogaster. Mol and
Cel Biol 22:3204-3218
Schott S, Coustham V, Simonet T, Bedet C, Palladino F (2006) Unique and redundant
functions of C. elegans HP1 proteins in post-embryonic development.
Developmental Biology 298:176-187
Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of
image analysis. Nature Methods 9: 671-675
Schwaiger M, Kohler H, Oakeley EJ, Stadler MB, Schübeler D (2010) Heterochromatin
protein (HP1) modulates replication timing of Drosophila genome. Genome
Research 20:771-780
Sdek P, Oyama K, Angelis E, Chan SS, Schenke-Layland K, MacLellan WR (2013)
Epigenetic regulation of myogenic gene expression by heterocromatic protein 1
alpha. PLoS ONE 8(3): e58319. doi:10.1371/journal.pone.0058319
Serrano A, Rodríguez-Corsino M, Losada A (2009) Heterochromatin Protein 1 (HP1)
do not drive pericentromeric cohesin enrichment in human cells. PLoS One
4(4): e5118. doi:10.1371/journal.pone.0005118
Sharma GG, Hwang KK, Pandita et al (2003) Human heterochromatin protein 1
isoforms HP1Hs alpha and HP1Hs beta interfere with hTERT-telomere
interactions and correlate with changes in cell growth and response to ionizing
radiation. Mol and Cel Biol 23(22):8363-8376
Spierer A, Seum C, Delattre M, Spierer P (2005) Loss of the modifiers of variegation
Su(var)3–7 or HP1 impacts male X polytene chromosome morphology and
dosage compensation. J Cell Sc.118:5047–5057
Stitou S, Díaz de la Guardia R, Jiménez R, Burgos M (2000) Inactive ribosomal cistrons
are spread throughout the B chromosomes of Rattus rattus (Rodentia, Muridae).
Implications for their origin and evolution. Chromosome Res 8(4):305-311
152
HP1 knockdown affects both eucromatin and heterochromatin
StatSoft, Inc. (2007) STATISTICA (data analysis software system), version 8.0.
www.statsoft.com
Studencka M, Wesolowski R, Opitz L, Salinas-Riester G, Wisniewski JR, Jedrusik-bode
M (2012) Transcriptional repression of Hox genes by C. elegans HP1/HPL and
H1/HIS-24. PLoS Genet 8(9): e1002940.doi:10.1371/journal.pgen.1002940
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during
meiosis and NOR activity of a B chromosome in the grasshopper
Eyprepocnemis plorans. Chromosome Res 15:755–765
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR
expression in a B chromosome of the grasshopper Eyprepocnemis plorans.
Chromosoma 118:291–301
Teruel M, Sørensen JG, Loeschcke V, Cabrero J, Perfectti F, Camacho JP (2011) Level
of heat shock proteins decreases in individuals carrying B-chromosomes in the
grasshopper Eyprepocnemis plorans. Cytogenet Genome Res 132(1-2):94-99
Van Hiel MB, Van
Wielendaele
P, Temmerman
L
et
al
(2009)
Identification and validation of housekeeping genes in brains of the desert
locust Schistocerca gregaria under different developmental conditions. BMC
Mol Biol 10:56. doi: 10.1186/1471-2199-10-56
Van Vugt JJFA, de Nooijer S, Stouthamer R, de Jong H (2005) NOR activity and repeat
sequences of the paternal sex ratio chromosome of the parasitoid wasp
Trichogramma kaykai. Chromosoma 114:410–419
Vermaak D and Malik HS (2009) Multiple roles for heterochromatin protein 1 genes in
Drosophila. Annu Rev Genet 43:467-492
Wang G, Ma A, Chow CM et al (2000) Conservation of heterochromatin protein 1
function. Mol Cell Biol 20(18):6970-6983
Warren CD (2002) Distinct chromosome segregation roles for spindle checkpoint
proteins. Mol Biol Cell 13:3029–3041
153
Supporting Information
Fig. S1 The HP1α gene contig from our E. plorans transcriptome library. The region
used for dsRNA is noted in red colour.
5’TAGAAGCTGGAGCACAGTTTCATCCCGCCAACCCTTCTTTGGCGCCGAAA
AATTCCTGAAGCTTCGAATCAGTTAAAGAAAGAGAAGATTTGTAGCTGTTT
GAAACCCTTTTCGCTACGAGTCGCAACATGTCAAAAATGGAAGGGCCAAAT
CGGAAGACAAAAGATAAGGATGCTGCAGGAAATAATGCAGATGGGGAAGA
GCCAGAGGAAGAGTACTCAGTTGAGAAAGTACTGGACAAGAGAATACGAA
ATGGCAAAGTGGAGTACTTATTGAAGTGGAAGGGGTATTCAAATGAAGATA
ACACGTGGGAACCAGAGGAGAATCTCGACTGCCCGGACCTCATCAGCGAAT
ACGAGTCGAAGAGGGCGGAGAGCAAGAAGGGTGGCAGCGGCAGTGACACA
GGGTCGACTGGTGTGAAGAAAGAAGACCGTAAGCGCAAGTCGAGTGCTGTC
ACCGAGGAGAAGAAAGGTTCCAGCAAGAAGAAGCACACTGAGGAAGATAA
CAAACCAAGGGGTTTTGAACGTGGTTTGGAACCAGAGAAGATTATTGGGGC
CACAGATTCAAGTGGAGAGCTAATGTTCCTAATGAAATGGAAAGGCACTGA
CGAAGCAGACCTCGTGCCTTCGAGCCAGGCCAATGTGAAGTGTCCGCAGAT
TGTGATAAAGTTCTACGAAGAGCGACTGACCTGGCACACCTCGAGCCACGA
TGAGGAGGAAGGTGGCAAAGGCGAGGGGGCGGCCTAAGTGTGGACACGGT
TGACACTCGCAGTGCACTGCAGCAGAGTTACTTCTTCTGGCTCCATAACTAG
TTCTAAGACAAATTCCCTTTAAATATTTTAGATCGGTTTTCACTTTTGATCCA
TAATGTTCACACAACGTACACCAGAGTGATTTTTATTTGAGCTGAGCACTTG
GAAGTGTGAAATTGAGACTGCACTAAATTTTTCAGTGTTGACGTTTTTGACC
GTGTTCCCGTAGGCTGCAAAATAAATCACACAGAATAGTAGCTTTAGGGTA
AGGAATACAATGACTGAAGAGTGACTTTTAAGAGGAGGTAGTGGTCAGAGA
TTCTGAATTGATTGAGGTCTTCTGGAAGTTCTTCATTTGTGCTGCATTTCTTT
TTTTGTTTCCCTTAGATTTGCCATATTTGCAATTTTAAGTGTTTGAAGTAGCA
GTGTTGATGTTAATTGTGGGTAGTCAATAAATCGATGGTGGAAAGGTAAAA
GGTTGTAATCCCTATTAGAATACATTGGGGTTACAACCTTTTACCTTTCAAC
CGTCGAAATCGTCTGATTAACTGTAATATTGTATCACCCATTTGGAGAGATG
ACATGTGAAAAATCTTGTGTGTTTATTCTGTAGTCCCCATCACATAGTTCCA
CTTTTGCATGTGATAATTGTCC 3’
154
HP1 knockdown affects both eucromatin and heterochromatin
Fig. S2 Metaphase I cell submitted to immunofluorescence with a Ku70 antibody (red)
merged with DAPI staining to show chromatin, from a male injected with RNAi for
HP1. Note the presence of one centromeric Ku70 focus per homologous chromosome,
and the distal associations between different bivalents (arrows). Ku70 was present in
both RNAi and control males.
Fig. S3 Metaphase I cell submitted to FISH with telomeric probe (green) merged with
DAPI (blue) from an RNAi male. Note the presence of apparently normal telomeric
signals in all bivalents, and how several signals are mixed together in the chromatin
bridges (arrow).
155
156
Capítulo 8. High variation of ITS2 rDNA
region and non-random expression of rDNA
units in a grasshopper genome
157
158
High variation of ITS2 rDNA region and non-random expression of
rDNA units in a grasshopper genome
Mercedes Ruiz-Estévez*, Francisco Ruiz-Ruano*, Josefa Cabrero, Mohammed Bakkali,
Francisco Perfectti, Mª Dolores López-León, Juan Pedro M. Camacho
Departamento de Genética, Universidad de Granada, 18071 Granada, Spain
*: These authors contributed equally to this work
Short title: High variable and non-randomly expressed rDNA
Key words: 454 amplicon sequencing, B chromosomes, cDNA, concerted evolution,
gDNA, gigantic genomes, homogenization, rDNA expression, rDNA, tagged PCR
159
Abstract
Concerted evolution is an evolutionary pattern by which some repetitive DNA arrays
show little or no intraspecific genetic diversity. One of the repetitive DNAs best fitting
concerted evolution is ribosomal DNA (rDNA), but the recent finding of extensive
intragenomic variation for rDNA non-coding regions in some organisms has challenged
the efficiency of concerted evolution as homogenizing mechanism. Here we analyze
intragenomic variation in the ITS2 rDNA region in two grasshopper species with
gigantic genomes (2-3 fold the human genome), by means of tagged PCR 454 amplicon
sequencing, and found highly contrasting patterns in them. The use of short coding
regions (5.8S and 28S rDNA) flanking the ITS2 proved to be an appropriate internal
control for haplotype selection. Whereas Locusta migratoria showed very high
homogenization, with a single ITS2 haplotype in 98.52% of the reads obtained, six
different haplotypes coexisted in a single population of Eyprepocnemis plorans,
suggesting efficient homogenization in the former but poor in the latter. In E. plorans,
one of the ITS2 haplotypes (Hap4) was specific to B chromosomes. The simultaneous
analysis of genomic DNA (gDNA) and complementary DNA (cDNA) allowed the
analysis of relative expression efficiency (REE) for the different haplotypes, and
showed different expression profiles between body parts which were consistent at
population level. Remarkably, Hap5 showed the highest REE and also carried the most
conserved flanking 5.8-28S coding regions, whereas Hap4 showed the lowest
conservation of the accompanying coding region and showed the lowest REE. The
meaning of these results in the context of B chromosome silencing and genomic
homogenization of rDNA arrays is discussed.
Introduction
Among a high variety of repetitive DNA sequences making up eukaryote genomes
(Britten and Kohne, 1968), ribosomal DNA (rDNA) is one of the most abundant tandem
repeats, and this facilitates synthesizing massive numbers of ribosomes during rapid
growth periods (Eickbush and Eickbush, 2007). Each 45S cistron of this multigene
family is constituted by three rRNA genes (18S, 5.8S and 28S) separated by two
internal transcribed spacers (ITS1 and ITS2) and preceded by the external transcribed
spacer (ETS) and the intergenic spacer (IGS) (Long and David, 1980). For many years,
it was believed that every copy in the rDNA arrays showed an identical sequence
(Goffeau et al., 1996), because natural selection would constrain the evolution of the
coding regions (Nei et al., 1997). But the finding of high sequence resemblance among
rDNA units also in the non-coding regions, suggested the existence of a mechanism for
their active homogenization. Brown et al. (1972) first proposed that the rRNA gene
copies evolved “horizontally”, with novel variants arising by mutation and spreading to
other units. This homogenization process was later called “concerted evolution”
(Zimmer et al., 1980), and it was suggested to occur through unequal crossover and
160
High variable and non-randomly expressed rDNA
gene conversion (Dover, 1982). Although the role of unequal crossover is universally
accepted, that of gene conversion has generated some doubts (Eickbush and Eickbush,
2007).
Concerted evolution was first though to fit all kinds of repetitive DNA
sequences, but some multigene families have been shown to best fit an alternative
evolutionary model, namely the birth-and-death model proposed by Nei and Hughes
(1992) for the Major Histocompatibility Complex (MHC) loci. This model has gained
later support for other gene families (Ota and Nei, 1994; Nei et al., 1997; Date et al.,
1998; Michelmore and Meyers 1998; Sitnikova and Nei, 1998; Gu and Nei, 1999; Nei
et al., 2000; Zhang et al., 2000; Rooney et al., 2002; Rooney and Ward, 2005). One of
the main differences between the birth-and-death and concerted evolution models is the
presence of pseudogenes in the first case (Eickbush et al., 1997).
In some organisms, including prokaryotes, plants, animals, and fungi, extensive
intragenomic variation has been reported for the ITS regions (Mayol and Rosselló,
2001; Feliner et al., 2004; Wörheide et al., 2004; Stage and Eickbush, 2007; Stewart and
Cavanaugh, 2007; Simon and Weiss, 2008; James et al., 2009; Pilotti et al., 2009; Alper
et al., 2011; Hřibová et al., 2011; Matyášek et al., 2012; Song et al., 2012; Vydryakova
et al., 2012; Li et al., 2013). This has suggested caution in using these genomic regions
in studies of species richness in environmental studies (Lidner et al., 2013), or in trying
to use them as universal barcodes (Alper et al., 2011; Song et al., 2012).
The absolute level of sequence variation in the rDNA repeated arrays can be
analyzed by Whole Genome Shotgun Sequencing, but only when the studied genomes
are relatively small. Using this approach, Ganley et al. (2007) determined that the level
of rDNA copy variation was extremely low in five fungi species, even in the IGS
region. They proposed a model of rapid homogenization based on concerted evolution,
where a polymorphism in an individual represents a mutation which the homogenization
mechanism has spread to all repeats in the array, thus becoming fixed. Another
appropriate method for thorough analysis of rDNA intragenomic variation is Next
Generation Sequencing (NGS) (Margulies et al., 2005; Sogin et al., 2006; Keller et al.,
2008; Meyer et al., 2008; Van Tassell et al., 2008; Druley et al., 2009; Wang et al., 2011;
Song et al., 2012; Lindner et al., 2013; Zavodna et al., 2013). Although NGS analysis
provides information that exceeds the traditional methods (e.g. Sanger sequencing) in
several orders of magnitude, some recent studies have revealed that the results from the
NGS platforms (454 and Illumina) are comparable to the traditional ones (Hřibová et
al., 2011; Matyášek et al., 2012). At the same time, other studies have detected much
higher polymorphism for NGS compared to Sanger sequencing (Tedersoo et al., 2010;
Kautz et al., 2013). These studies have also highlighted the need to control for
sequencing errors in order to avoid false positives (Gilles et al., 2011; Brodin et al.,
2013; et al., 2013; Niklas et al., 2013).
Eukaryotes show extensive variation among species for both genome size and
the amount of ribosomal DNA (rDNA). Although these two parameters are positively
correlated, there is no simple explanation for this relationship (Prokopowich et al.,
161
2003) since only part of the rDNA copies are usually active (Reeder 1999). Even more
puzzling is the finding of extensive intraspecific variation in the amount of rDNA
without changes in the number of protein-coding genes. The grasshopper
Eyprepocnemis plorans shows dramatical variation in the number of rDNA units among
populations, from only two chromosome pairs carrying rDNA in Dagestan to all
chromosomes carrying it in Morocco (López-León et al., 2008). The genome of this
species is about three times larger than the human genome and, in some Spanish
populations, may carry more than 40,000 rDNA units in individuals carrying
supernumerary (B) chromosomes (Montiel et al., submitted), a figure being among the
largest ever found. B chromosomes in this species are very rich in a 180 bp satDNA and
45S rDNA (Cabrero et al., 1999). Recently, Montiel et al. (submitted) have estimated
that B-lacking males from the Torrox (Málaga, Spain) population (the one analyzed
here) carry 15,000 rDNA units which, by fluorescent in situ hybridization (FISH) can be
observed in seven A chromosome pairs (Cabrero et al., 2003). The most conspicuous
rDNA clusters are located in the three smallest autosomes (9, 10 and 11) as well as in
the X chromosome (X0/XX sex determinism). But the largest rDNA cluster is located
on the B chromosome (López-León et al., 1994; Cabrero et al., 1999). In most males, all
rDNA-carrying A chromosomes can eventually be visualized organizing a nucleolus
during meiotic prophase, but NOR activity in the B chromosomes is rarely observed
(Cabrero et al., 1997; López-León et al., 1995; Ruíz-Estévez et al., 2013), except in the
Torrox population (Teruel et al., 2007; 2009; Ruiz-Estévez et al., 2012).
The grasshopper Podisma pedestris, a species with a gigantic genome (18.15
Gb), also shows extensive intraspecific variation in the number of rDNA repeats
(Veltsos et al., 2009) which show high sequence heterogeneity, suggesting low
efficiency of concerted evolution (Keller et al., 2006, 2008). To investigate whether this
is a general property of grasshoppers or if it is a characteristic of large genomes, we
performed tagged PCR and 454 amplicon sequencing to analyze variation for the ITS2
region in two other grasshopper species (Locusta migratoria and Eyprepocnemis
plorans) showing genomes not as large as P. pedestris (5.56 Gb and 10.26 Gb,
respectively; see Ruiz-Ruano et al., 2011), and differing in the number of rDNA clusters
visualized by FISH, with only three chromosome pairs in L. migratoria and seven in E.
plorans (Cabrero et al., 2003; Teruel et al., 2010). Since preliminary experiments
showed extensive ITS2 variation in the latter species, we performed additional
experiments to characterize intragenomic ITS2 variation at body part and population
levels by analyzing both genomic DNA (gDNA) and complementary DNA (cDNA)
from the same individuals. This allowed us to detect the presence of a B-specific
haplotype and analyzing relative expression level among haplotypes which revealed
strong silencing of the rDNA contained in the B chromosome.
162
High variable and non-randomly expressed rDNA
Materials and methods
Biological samples and karyotypic characterization
We collected 21 adult males of the grasshopper E.plorans in the Torrox population
(Málaga, Spain) and one Locusta migratoria male from our B-lacking laboratory
culture. They were anesthetized prior to dissection to take out the testes which were
fixed in freshly prepared 3:1 ethanol:acetic acid and stored at 4ºC for cytological
analysis. The bodies of 18 E.plorans males were divided into two somatic hemibodies
for separate extraction of DNA and RNA. One male was dissected under a binocular
microscope into six body parts (head, hind leg, wing muscle, testis, accessory gland and
gastric caecum). These hemibodies, the mentioned body parts, and body remains of one
L.migratoria male and two E.plorans males were frozen in liquid nitrogen and stored at
-80º C until DNA and RNA extraction.
Determination of the number of B chromosomes in each E. plorans male was
performed by squashing two testis follicles in 2% lacto-propionic orcein and visualizing
primary spermatocytes at first meiotic prophase or metaphase, under a BX41 Olympus
microscope coupled to a DP70 digital camera.
gDNA and RNA extractions, cDNA synthesis and B-NOR activity analysis
Genomic DNA (gDNA) and total RNA extractions from frozen hemibodies and
dissected body parts were performed using “GenElute Mammalian Genomic DNA
Miniprep Kit” (Sigma) and “Real Total RNA Spin Plus kit” (Durviz), respectively,
following manufacturer’s recommendations. We submitted total RNA to a second 20U
DNase treatment (REALSTAR kit, Durviz) after extraction to eliminate any traces of
gDNA contamination. Quantity and quality (absorbance 260:280 nm = 1.9-2) of gDNA
and RNA were measured with Tecan's Infinite 200 NanoQuant and in a denaturing
agarose gel to ensure the absence of RNA degradation. Complementary DNA (cDNA)
was obtained with random hexamers using SuperScript III First-Strand Synthesis
SuperMix Kit (Invitrogen). B-NOR activity was analyzed by Silver Impregnation of
testis follicles following the protocol reported by Rufas et al. (1982) and by PCR
amplification of the ITS2_B sequence (preferentially found in the B-rDNA) following
the protocol described in Ruiz-Estévez et al. (2012).
Tagged PCR and amplicon NGS sequencing
We amplified the ITS2 region in four separated 454 runs in: 1) gDNA from a L.
migratoria male, 2) gDNA from a 1B E.plorans male, 3) gDNA and cDNA of the six
body parts from a 0B E.plorans male, and 4) gDNA and cDNA from 18 E.plorans
males with different number of B chromosomes. The ITS2 amplicons in 1) and 2) were
sequenced as part of 1/4 of plate along with other PCR products not analyzed here, and
samples 3) and 4) were sequenced in 1/8 of a plate each. We used forward ITS3 (5’
GTCGATGAAGAACGCAGC
3’)
and
reverse
ITS4
163
(5’ATATGCTTAAATTCAGCGGG 3’) primers (anchored in the 5.8S and the 28S
genes, respectively) with 6mer-length tags in the 5’ end of both primers. For each
different sample we used a specific combination of both forward and reverse tagged
primers to separate them in silico. We designed six tags using EDITTAG (Faircloth and
Glenn, 2012), five of them with an edit distance of 5 and one with 4 (Table S1) and we
amplified 36 samples (18 gDNAs and 18 cDNAs). We ordered 12 tagged primers and
combined them to obtain 12 and 36 tagged amplicon samples in the body part and
population experiments, respectively. By doing this in our laboratory, costs were
diminished.
PCR reactions contained 20ng gDNA or 30ng cDNA, 0,4µM of each forward
and reverse tagged primer (Tables S2 and S3), 0,2 mM dNTPs, 5µl of 5X Phusion HF
Buffer and 0,4U Phusion® High-Fidelity DNA Polymerase (Thermo Scientific) in a
final volume of 25µl. PCR amplification of the ITS2 sequence was performed in an
Eppendorf Mastercycler ep Gradiente S (Eppendorf) with the following conditions:
initial denaturation for 30 s at 98ºC, 30 cycles of 15 s at 98ºC, 30 s at 60ºC and 10 s at
72ºC, followed by a final extension of 7 min at 72ºC. The results were visualized by
electrophoresis in a 1.5% agarose gel, and the bands of about 350 bp were excised, and
purified with the GenElute Gel Extraction Kit (Sigma-Aldrich). We performed two
separated reactions with the same combination of tags for each sample to reduce PCR
bias, and mixed the product in equimolar amounts for sequencing in a 454 GS FLX
Titanium equipment (Roche Diagnostics).
Data analysis
We used a series of custom scripts written in Python to count the number of reads in
each sample for the different types of sequences found. We performed it in five
consecutive steps: 1) We searched in the first half of the read the sequence of both
forward and reverse primers in the complete read collection by performing a local
alignment with the Smith-Waterman algorithm implemented in the EMBOSS suite
(Rice et al., 2000). We only considered reads with high identity with at least one primer
in any orientation. 2) We then made a local alignment for the tagged primers used in the
experiment in order to eliminate those reads showing more than three differences in the
sequence of both primers (F and R), and the remaining reads were assigned to every
sample according to tag combination (see tables S2 and S3). 3) After correcting some
sequencing errors with the Acacia software (Bragg et al., 2012), we created a file with
sequence types and number of reads, and then we searched for chimeric sequences with
UCHIME (Edgar et al., 2011) with default options of the de novo algorithm. 4) We
aligned the sequences using MAFFT v7 (Katoh and Standley, 2013) with LINSI options
and manually eliminated tags and primers with Geneious v4.8 (Drummond et al., 2009).
5) Since the 454 reads included partial sequences of the 5.8S and 28S rRNA genes,
summing up 123 nt, in addition to the ITS2 region, we used this partial coding region as
an internal control for sequencing errors, as a means to avoid false positives in
identifying genuine ITS2 haplotypes in the gDNA. For this purpose, we assumed that all
164
High variable and non-randomly expressed rDNA
variation found in these 123 nt were sequencing errors, since natural selection does not
allow much variation in them. The proportion of reads carrying any variation in respect
to the majoritary coding sequence type was thus an estimate of the maximum error rate
(ER) of the experiment. In order to select haplotypes in the different samples of an
experiment, we calculated ER in the whole experiment and then applied it to every male
in order to avoid discarding haplotypes very frequent in only one or few males. The
reads were then classified into one or more ITS2 haplotypes surpassing the ER
threshold.
Whole-Genome Shotgun Sequencing-NGS
To analyze the diversity of ITS2 in the genome without possible biases induced by the
PCR amplification, we used a library generated in our laboratory of gDNA sequences
obtained from an individual collected in Torrox with two B24 chromosomes in 1/8 of
454 GS FLX Plus. We mapped the reads showing at least 90% identity with the E.
plorans ITS2 (accession number JN811827) using the Roche’s GS Mapper software and
selected those with the complete ITS2 that were found more than two times.
Secondary structure and genetic diversity analyses
We predicted the ITS2 secondary structure of each haplotype and its stability measured
by Gibbs’ free energy with MFold v2.3 (Zuker, 2003) with a folding temperature of
30ºC, and the folds were represented with VARNA (Darty et al., 2009). We performed
the sequence diversity analysis with DNAsp v5 (Librado and Rozas, 2009). A minimum
spanning tree (MST) was built with the different haplotypes based on pairwise
differences, with Arlequin v3.5.1.3. (Excoffier and Lischer, 2010) and was edited with
HapStar v0.7 (Teacher and Griffiths, 2011). An additional haplotype from
Eyprepocnemis plorans meridionalis, a B-lacking subspecies located in South Africa,
was included for anchoring the haplotype network.
Statistical analyses
Read counts failed to fit a normal distribution (tested by the Shapiro Wilk’s test) and
thus we used non-parametric tests such as Kruskal-Wallis ANOVA, Wilcoxon matched
pairs test and Friedman two-way ANOVA. All analyses were performed with
STATISTICA Software v8 (StatSoft, Inc. 2007).
Results
Preliminary analysis of ITS2 variation
We first performed ITS2 amplicon sequencing on gDNA from two individuals, one L.
migratoria male, and a 1B E. plorans male. The L.migratoria experiment yielded 2,366
165
reads; 2318 (97.97% ) were identical for the 5.8-28S coding region thus suggesting ER=
2.03%. For the ITS2 region, there were 2,331 (98.52%) identical reads , and six other
types showed frequencies being 0.25% or lower thus not surpassing the ER threshold.
Therefore, we conclude that L.migratoria showed a single haplotype for the ITS2
region.
The 1B E. plorans male yielded 10,672 reads matching the ITS2 sequence of
this species (accession numbers: JN811827 to JN811902), but only 76.41% of them
showed a conserved 5.8-28S coding region. This could be the result of either high rate
of sequencing error or else to the presence of degenerate rDNA copies in the B
chromosome. Since it was impossible to ascertain the true cause, we did not apply the
ER threshold to this male. The analysis of the ITS2 sequence types observed in these
reads showed only four types with frequencies higher than 5%: Hap1 (10.39%), Hap2
(30.15%), Hap3 (5.93%) and Hap4 (10.48%), the remaining types (about 600 nonsingleton reads, and more than 1700 including singletons) showing frequency 0.41% or
lower. Out of them, Hap4 was the only one including the adenine insertion typical of the
ITS2_B variant (Ruiz-Estévez et al., 2012; Teruel et al., submitted).
As another test for ITS2 variation found, we performed Whole Genome Shotgun
454 sequencing on gDNA from a 2B E. plorans male from the same population and
found 27 complete ITS2 sequences. Haplotype characterization showed five haplotypes
including the four formerly found (Hap1-Hap4) and a new haplotype (Hap5, which had
appeared in the 1B male analyzed by amplicon sequencing in 0.46% of non-singleton
reads). On the basis of these results, we designed two amplicon NGS experiments to
analyze the ITS2 variation (on gDNA) with coverage higher than 1x, as well as the
expression degree of the different haplotypes (on cDNA), at both body part and
population levels.
Body part experiment
The 454 amplicon sequencing experiment including both gDNA and cDNA extracted
from six different body parts (head, hind leg, wing muscle, testis, accessory gland and
gastric caecum) from a 0B male yielded 46,572 reads in the gDNA matching the ITS2
sequence. Bearing in mind that 0B males from the Torrox population carry about 15,000
rDNA units, we actually got 3x coverage for the ITS2 in the gDNA reads. 97.4% of
these reads were identical for the 5.8-28S coding region thus indicating ER= 2.6%.
Only three ITS2 sequence types surpass this ER threshold in frequency, the remaining
516 types showing very low frequency (1.08% or less). The three most frequent types
corresponded to Hap1-Hap3 previously found, and they collectively represented 94.92%
of total reads. After discarding this 5.08% of reads, about half of the remainder
(50.79%) corresponded to Hap1, 26.98% to Hap2, and 22.24% to Hap3. Remarkably,
the Hap4 haplotype, with the adenine insertion typical of the ITS2_B, was not found in
this B-lacking male.
In the cDNA, these three haplotypes appeared in 49,683 reads, 65.18% of which
166
High variable and non-randomly expressed rDNA
corresponded to Hap1, 27.28% to Hap2, and 7.54% to Hap3. The proportion of reads
found for a given ITS2 haplotype in the cDNA divided by the proportion of reads found
in the gDNA (cDNA/gDNA ratio) is an indicator of its expression efficiency. Dividing
the efficiencies of the three haplotypes in a body part by the highest of them, we
calculated the relative expression efficiency (REE) for the different haplotypes, which
showed different patterns among body parts (Fig. 1).
1
0.9
0.8
0.7
0.6
Hap1
0.5
Hap2
Hap3
0.4
0.3
0.2
0.1
0
Head
Caecum
Access.gland
Wing muscle
Hind leg
Testis
Fig. 1 Relative expression efficiency of the three ITS2 haplotypes in six body parts of a
0B male of the grasshopper E. plorans. Note that Hap1 showed the highest efficiency
(defined as the cDNA/gDNA ratio of read counts) in four somatic body parts, whereas
Hap3 showed the lowest efficiency in all body parts, although differences between body
parts were lower in testis. In general, the different body parts analyzed showed different
expression profiles for the three haplotypes. Remarkably, the patterns were almost
identical in the two most important muscles of the grasshopper, i.e. the wing and hind
leg muscles.
Population experiment
With these antecedents, we wanted to get an idea on ITS2 variation and expression at
population level, for which purpose we designed an ITS2 amplicon sequencing
experiment on 18 E.plorans males from the same population (Torrox). Six of these
males lacked B chromosomes (0B) and the remaining 12 males carried different number
of B chromosomes. The total sample obtained included 150,685 reads, of which,
130,742 matched the ITS2 sequence (66,617 gDNA and 64,125 cDNA reads). This
implied about 4x coverage in the gDNA.
The 5.8-28S coding region was identical in 97.72% of reads (ER= 2.28%), in
high contrast with the ITS2 region where the most frequent haplotype included only
35.79% of total reads. After applying this ER threshold to each male gDNA sample
separately, only six ITS2 haplotypes (Hap1-Hap6) appeared in more than 2.28% of
reads from one or more males (see counts in Table 1). We therefore discarded the
remaining hundreds of minority sequence types because many of then could be the
167
product of sequencing errors. Hap1-Hap5 had also been found in the preliminary
experiments (see above) and Hap6 surpassed ER in four males. As a whole, the 62,322
reads for these six haplotypes comprised about 93.6% of all gDNA reads. They included
445-9,182 reads per male, with 3,462 reads on average (SE= 535). A total of 63,040
reads for these six haplotypes were obtained from the cDNA, with 3,502 per male on
average (SE= 363). The number of total amplicons obtained from gDNA and cDNA in
each male did not show significant differences (Wilcoxon test, T= 83, N=18, P= 0.91)
suggesting that the experiment worked similarly for both kinds of DNA.
Table 1. Read counts in the gDNA and cDNA from the 18 males analyzed.
Id Bs Hap1 Hap2
51 0 1151
745
53 0 2224 1502
57 0 1088 1031
65 0 2354 2139
70 0
976
724
80 0 2290 1467
24 1 1013 965
44 1 2347 1502
46 1
300
420
48 1 1376 1060
49 1
181
86
54 1
455
338
66 1
928
849
69 1 1427 804
55 2
421
257
63 2 2617 1476
50 3
938
257
62 3 1584 702
Total 23670 16324
Hap3
337
1202
641
884
556
768
329
1018
215
313
136
136
283
375
238
648
191
675
8945
gDNA
Hap4
0
0
0
0
0
0
801
524
104
406
17
143
387
348
418
4117
503
1437
9205
Hap5 Hap6 Total
4
44
2281
1626 175 6729
123
51
2934
245 111 5733
551
48
2855
0
165 4690
6
46
3160
0
183 5574
0
8
1047
0
61
3216
25
5
450
0
9
1081
0
66
2513
3
61
3018
0
17
1351
324 113 9295
0
26
1915
0
82
4480
2907 1271 62322
Hap1
2477
1560
1168
2425
778
2852
0
421
727
2254
238
3076
490
1413
2417
5242
2096
2426
32060
cDNA
Hap2 Hap3 Hap4 Hap5 Hap6 Total
907
718
0
1
41
4144
1929 231
0
1569
0
5289
276
478
0
525
14
2461
1887 125
0
308
0
4745
904
199
0
785
0
2666
1812 183
0
2
0
4849
258
0
0
3
0
261
2618 229
0
0
8
3276
1733 146
0
0
10
2616
604
84
0
0
18
2960
1619 315
26
720
5
2923
1214 658
90
0
53
5091
429
163
0
195
0
1277
960
313
0
689
0
3375
868
351
0
1
15
3652
908
328
94
277
28
6877
302
275
63
0
12
2748
578
673 132
0
21
3830
19806 5469 405 5075 225 63040
Exploration of variation for haplotype counts in gDNA by means of Factor
Analysis arranged the haplotypes into two main factors, one of them explaining 65.8%
of variance and including Hap1, Hap2, Hap3 and Hap6, and the other explaining 18.4%
of variance and including only Hap4 (Supplementary Table S4, Figure S1). This
analysis suggests a remarkable difference between Hap4 and the other haplotypes.
Given that most haplotype counts failed to fit a normal distribution, we used non
parametric Kruskal-Wallis ANOVA with the number of B chromosomes (0, 1, 2, and 3)
as independent variable and read counts for each haplotype in the gDNA as dependent
variable. Only Hap4 showed significant association with the number of B chromosomes
(H= 13.76, df= 3, P=0.0033). Bearing also in mind that we have not found this
haplotype in any of the B-lacking males, these results suggest that Hap4 is specific to B
chromosomes.
168
High variable and non-randomly expressed rDNA
All six haplotypes showed a conserved secondary structure composed of three
arms (helix I, helix II and helix III) differing in size (see fig. 2), in coincidence with that
previously described for this species (Teruel et al., submitted). Thermal stability (dG=
Kcal/mol) was also highly conserved, ranging from -93.15 for Hap1 to -87.17 for Hap2,
with -92.57 on average (SE=1.47).
Fig. 2 Secondary structure of Hap1 and the five other ITS2 haplotypes (Hap2-Hap6)
found in E.plorans after analyzing 18 males from the Torrox population. Note that, in
respect to Hap1, Hap6 carries a hemicompensatory change in position 97, which is also
present in Hap3. But the latter also carries a hemicompensatory change in position 151
and a non compensatory change in position 153. These two latter changes are also
present in Hap2, but it lacks the change in position 97. Hap4 carries an adenine insertion
around positions 169-171, whereas Hap5 carries a CAA repetitive insertion of this triplet
in positions 168-170.
The minimum spanning tree showing the relationships among the six ITS2
haplotypes indicated that Hap1 is the haplotype most similar to the E. p. meridionalis
outgroup (Fig. 3), thus suggesting that it can be the ancestral haplotype for the Torrox
population, as is also suggested by its central position in the tree. The coexistence of six
different haplotypes in a single population, with up to four mutational events between
the most divergent ones, suggests that rDNA sequence homogenization shows low
efficiency for the ITS2 region in this species, specifically much lower than that
observed for the 5.8-28S coding region.
169
Fig. 3 Minimum spanning tree showing the relationships between the six ITS2
haplotypes found in 18 E. plorans males from Torrox, based on their DNA sequences.
The nature of these mutational changes is indicated in Figure 2 and, in brief, they were
substitutions, excepting an indel of one nucleotide in Hap4, another of three nucleotides
in Hap5 and another of 15 nucleotides in the E. p. meridionalis haplotype.
Differential expression among haplotypes
The degree of expression for each haplotype can be assessed by comparing the
proportions of reads found in gDNA and cDNA. For this analysis, we first calculated
the proportion of read counts for each haplotype per male in order to give similar weight
to each male. We then calculated an index of absolute expression efficiency (AEE) for
each haplotype as the quotient between the cDNA and gDNA proportions in each male.
Finally, we calculated the relative expression efficiency (REE) in each male by dividing
each haplotype AEE by the highest of haplotype AEEs in the same male. We them
compared REEs between haplotypes by means of Friedman two-way ANOVA, in
different subsets of males since Hap4 was only present in the 12 B-carrying males and
Hap5 was present only in 5 B-lacking and 4 B-carrying males. A first analysis excluding
Hap4 and Hap5 showed significant differences between Hap1-Hap3 and Hap6 (χ2=
26.25, N= 18, df= 3, P<0.00001; Kendall coefficient of concordance: W= 0.49). When
Hap4 was included in the analysis (B-carrying males only), the differences were also
highly significant (χ2= 28.39, N= 12, df= 4, P<0.00001; Kendall coefficient of
concordance: W= 0.59). When Hap5 was included, instead of Hap4, the differences
were also significant (χ 2= 19.36, N= 9, df= 4, P<0.00067; Kendall coefficient of
concordance: W= 0.54). Only four males carried the six haplotypes, but the Friedman
analysis still yielded significant differences among haplotypes even in this small sample
(χ2= 15, N= 4, df= 5, P<0.01036; Kendall coefficient of concordance: W= 0.75). These
analyses, as a whole, showed that Hap5 had the highest efficiency; in fact, it was the
most efficient haplotype in six out of the nine males carrying it. Hap1 and Hap2 were
the second and third in REE, but did not differ between them. However, Hap3 and Hap6
showed significantly lower REE values, and Hap4 showed the lowest value suggesting
strong repression (Figure 4). This result indicates that haplotypes are not randomly
expressed but, on the contrary, some selection for expression is taking place, the most
170
High variable and non-randomly expressed rDNA
apparent being the active repression of Hap4 and the overexpression of Hap5. An
indirect manifestation of such selection is the fact that nucleotide diversity per male for
the ITS2 region was significantly higher in gDNA than cDNA (Wilcoxon test: T= 3, N=
18, P= 0.0003), indicating that only a subset of haplotypes are expressed.
1.00
0.80
0.60
0.40
0.20
0.00
Hap1
Hap2
Hap3
Hap4
Hap5
Hap6
Fig. 4 Relative Expression Efficiency of the six ITS2 haplotypes (Hap1-Hap6) found in
18 E.plorans males from Torrox. Error bars indicate ±1.96*SE. Values shown for Hap1Hap3 and Hap6 are based on N=18, that for Hap4 on N= 12 (B-carrying males) and
Hap5 on N= 9.
In all 12 males carrying B chromosomes, we analyzed at least 20 diplotene cells
submitted to silver impregnation that, in grasshoppers, reveals nucleoli attached to the
chromosome regions containing the rDNA. In all five B-carrying males where we found
454 reads for Hap4 in the cDNA, we could visualize some diplotene cells showing a
nucleolus attached to the B chromosome region containing the rDNA.
A comparative analysis of sequence conservation for the 5.8-28S coding region,
flanking the ITS2 reads, showed significantly higher conservation in the cDNA than in
gDNA, the proportion of reads carrying a conserved coding sequence of 99.03% and
98.24%, respectively (Wilcoxon: T= 33, N= 18, P= 0.022). A comparison among the
cDNA of the six haplotypes showed that this proportion was 100% only in Hap4, the
remaining haplotypes showing lower averages: 99.53% for Hap5, 99.33% for Hap2,
99.20% for Hap3, 98.46% for Hap1 and 96.89% for Hap6. A similar analysis in the
gDNA reads showed that Hap5 showed the highest conservation of adjacent coding
sequences (in 99.28% of reads), followed by Hap6 (98.98%), Hap3 (98.64%), Hap1
(98.22%), Hap2 (98.07%) and Hap4 (98.01%). This suggests that the ITS2 haplotype
being accompanied by the most conserved 5.8-28S regions in gDNA (Hap5) showed the
highest REE, whereas that being accompanied by the least conserved coding regions
(Hap4) showed the lowest REE, thus suggesting nonrandom expression of rRNA genes.
171
Discussion
The huge amounts of DNA sequences provided by the 454 amplicon sequencing
experiments performed here yielded about 3x and 4x coverages for the body part and
population experiments, respectively. The resulting reads included many different
sequence types, some of which could be the product of PCR or sequencing errors.
Avoiding these errors is a repeated concern in the recent literature. Brodin et al. (2013)
concluded that most sequencing errors are introduced by PCR prior to sequencing. To
minimize this problem, we used the Phusion polymerase whose error rate is very low
(4.4x10-7). The most frequent errors inherent to 454 pyrosequencing appear to be
associated with the presence of homopolymers, and tend to occur at sequence ends
(Gilles et al., 2011; Niklas et al., 2013). Although average error rate rarely surpasses
1%, it may reach 50% for indels in homopolymers. To cope with this problem, Gilles et
al. (2011) recommended the use of internal controls to correct for errors.
Our experiment provides an internal control for sequencing errors since the reads
obtained included a 123 nt sample of the coding 5.8-28S rDNA at both ends of the ITS2
region, which also limits the incidence of errors in the latter by setting it centrally in the
read. The most abundant haplotype for this coding region was identical in E. plorans
and L. migratoria (and other acridid species, Ruiz-Ruano et al., in preparation), and was
highly conserved in both species. The error rate estimations based on this internal
control were about 2.03% in L. migratoria and 2.28-2.6% in E. plorans. This allowed
accurate haplotype selection for the ITS2 region in the latter species, safely discarding
false positives among the hundreds of different sequence types found. Additional
evidence that Hap1-Hap5 were genuine haplotypes comes from their presence in our
preliminary experiments and in PCR-cloning-Sanger experiments by Teruel et al.
(submitted). Matyášek et al. (2012), in a similar experiment analyzing the coding and
ITS1 regions of rDNA in several Nicotiana species, by means of 454 amplicon
sequencing, considered only those haplotypes showing frequencies higher than 5%. In
E. plorans, the application of this filter would have left only Hap1-Hap4, thus excluding
Hap5 whose frequency was 4.5% in the population experiment and reaches 12% in a
Moroccan population, and Hap6 which surpasses the 5.8-28S threshold in a Spanish
population (Ruíz-Ruano et al., in preparation). Therefore, we suggest that using a partial
coding 5.8-28S sequence as internal control is a good method for filtering against 454
sequencing errors.
The existence of six different ITS2 haplotypes in E. plorans from a single
population is a clear indication of a remarkable intragenomic variation for this rDNA
region in this species, in clear contrast with the case of L. migratoria, where a single
haplotype was found. One of the E. plorans haplotypes (Hap4) has shown to be specific
to B chromosomes, since it was not found in any of the B-lacking individuals analyzed,
and read counts for it were significantly associated with the number of B chromosomes.
This haplotype was unique in showing the adenine insertion characteristic of the
ITS2_B sequence on which previous molecular detection of B-specific transcripts was
based (Ruiz-Estévez et al., 2012). We cannot rule out that some of the minority
172
High variable and non-randomly expressed rDNA
sequence types found in B-carrying males, also carrying this adenine insertion, could be
genuine variants located in the B chromosomes, but this needs additional research.
The secondary structure of ITS2 plays an important role in defining the cleavage
sites for release of rRNA during its maturation (Musters et al., 1990; van der Sande et
al., 1992). The secondary structure of the six haplotypes found in E. plorans was much
conserved, in consistency with previous findings by Teruel et al. (submitted), and Gibbs'
free energy was very similar among the five haplotypes, suggesting that all of them
have the capability for expression, and all of them were actually found in the cDNA. In
respect to Hap1, the other haplotypes showed sequence changes including
hemicompensatory changes in Hap2, Hap3 and Hap6, non-compensatory changes in
Hap2 and Hap3, and indels in Hap4 (A) and Hap5 (CAA) (see Fig. 2). The most
frequent haplotype (Hap1) was also the ancestral haplotype for this population, given its
connection with the ITS2 sequence found in the subspecies E. p. meridionalis in the
MST, and is also the most frequent haplotype in B-lacking individuals from other
E.p.plorans populations in the Mediterranean area (Ruiz-Ruano et al., in preparation).
The existence of up to 4 mutational events among the most divergent haplotypes
suggests that homogenization is poorly efficient in this species.
The simultaneous analysis of haplotype frequency in gDNA and cDNA of the
same individuals allowed the analysis of haplotype efficiency in expression,
demonstrating that it differs among body parts within a same individual, and also
between individuals. To our knowledge, this is the first study performing this kind of
combined analysis. Although a preliminary result, it was remarkable that the two main
muscle tissues (wing muscle and hind leg), which provide the two most important
movements of grasshopper activity (flight and jump) showed the same pattern (see Fig.
1). In addition, two other somatic body parts (head and male accessory gland) showed
the same tendency of Hap1 overexpression and Hap3 underexpression, in consistency
with observations at the population level. However, the fifth somatic body part (gastric
caecum) was different in showing more expression for Hap2 than for Hap1, with Hap3
being almost completely repressed. The significance of these differences among somatic
body parts is unknown, although it is clear that its evolutionary transcendence is
irrelevant since only the testis is associated with the germ line. Although we did not
analyze germ cells alone, the expression in testis suggests that the observed differences
among haplotypes are less apparent since all three haplotypes showed about similar
proportions in gDNA and cDNA (see Fig. 1).
In the population experiment, we also observed significant underexpression of
Hap3, in concordance with findings in the somatic body parts and consistent with the
fact that the cDNA of the 18 males was obtained from testis-lacking hemibodies. It has
been suggested that rDNA homogenization might have something to do with its activity
(Lim et al., 2000; Dadejová et al. 2007). Since only the homogenization associated with
the germ line is significant for concerted evolution, the simultaneous analysis of gDNA
and cDNA in germ cells could serve to test this hypothesis. Even though our results are
not conclusive to this respect, they suggest that the most abundant haplotypes (Hap1
and Hap2) tend to show high REE, whereas other less abundant haplotypes (e.g. Hap3
173
and Hap6) are less present in the cDNA (i.e. low REE). However, Hap5 is exceptional
for showing the highest REE in six out the nine males where it was present, perhaps
because it is a young haplotype as also evidenced by its highest homogeneity for the
adjacent coding regions.
The case of Hap4 was special since it is exclusive of the B chromosome, and it is
extremely underexpressed with only five of the 12 B-carrying males showing cDNA
reads, in much lower proportions than in gDNA. Remarkably, these five males showed
the presence of nucleoli attached to B chromosomes in silver stained diplotene cells,
indicating that the rDNA contained in the B chromosomes is able to yield its phenotype,
i.e. the nucleolus. Our results also indicate that B chromosome rDNA is completely
silenced in some males and is still highly silenced in those males carrying B
chromosomes being able to yield a nucleolus. In fact, a survey in 11 natural populations
harboring four different B chromosome variants showed B-NOR expression in 18 males
from seven populations, representing 11.66% of all 156 males analyzed (Ruíz-Estévez
et al., 2013). This frequency is much lower than the 48% observed in the Torrox
population (Ruíz-Estévez et al., 2012).
Our present results also indicate that the rRNA produced in the nucleoli yielded
by the B chromosome is enriched in rDNA coding regions being linked to the B-specific
ITS2 (Hap4). It would thus be interesting to know about the possible functionality of
this rRNA since cells tightly regulate the total amount of nucleolar area (Teruel et al.,
2007, 2009) and this implies that the rRNA copies produced by the B chromosome go in
detriment of copies produced by the A chromosomes. As commented above, our
analysis of secondary structure and Gibbs free energy appears to indicate that the ITS2
region produced by the B chromosome (Hap4) is as functional as that transcribed from
other chromosomes, although this is important only in terms of ITS2 elimination from
the transcript. However, the higher degree of sequence conservation for the 5.8-28S
coding regions in the cDNA, compared to that in gDNA, suggests some selection for
expression of rDNA units with higher sequence conservation for expression. This kind
of non-random expression of rDNA units is consistent with the observation by Flavell et
al. (1988) that unmethylated cytosines are not distributted at random in the rDNA but is
related to the activity of the NOR in which they reside. Recently, Zhou et al. (2013)
have proposed a model by which a genome containing copies of the R2 retrotransposon
in the 28S rDNA selects transcription domains in the region containing the fewest R2
insertions, which is also consistent with non-random expression of rDNA units. The fact
that Hap4 (the B-specific haplotype) was the only one associated with 100% of
completely conserved flanking coding regions in the cDNA, suggests that this selection
is more stringent when the rDNA is transcribed from the B chromosome. This suggests
that B copies are fully functional. In the E. plorans genome, R2 retroelements are
preferentially located in B chromosomes, but Bs actually constitute a sink for R2 since
the rDNA of the B chromosomes is rarely active and, as shown here, its most
representative ITS2 haplotype (Hap4) is highly repressed. The fact that the few Hap4
copies escaping silencing (thus observed in the cDNA) show the flanking coding
regions completely conserved suggests that the genome is extremely careful about
174
High variable and non-randomly expressed rDNA
which rDNA copies are active, especially in a genome with so much rDNA only
needing to express a small proportion of it.
How is haplotype differential expression possible bearing in mind that, at least in
Arabidopsis thaliana, the units of rRNA regulation are NORs (i.e. the rDNA clusters
located in every chromosome) rather than individual rRNA genes (Lewis et al., 2004)?
In previous analysis by means of silver impregnation, we showed the interdependence
of NOR expression among several chromosomes in E. plorans (Teruel et al., 2009). If
the unit of regulation is the NOR, the differential expression among haplotypes is only
possible if haplotypes are not distributed at random in the different chromosomes
carrying rDNA. The analysis of the ITS2 sequences obtained by microdissection and
PCR-cloning from individual chromosomes (Teruel et al., submitted) shows that 42 out
of 72 sequences analyzed matched five of the six haplotypes analyzed here, with Hap1
being the most ubiquitous haplotype found in at least the chromosomes 8, 9, X and B,
whereas Hap2 was found only in chromosome 11 and Hap4 was exclusive to the B
chromosome. Although more ITS2 sequences need to be individually analyzed from
each chromosome, this preliminary result suggests some structuring in ITS2 haplotype
distribution among chromosomes. This is presumably a consequence of poor nonhomologous homogenization of the ITS2 region in E. plorans, although this fact does
not apply to the 5.8-28s coding regions which are highly homogenized, presumably due
to higher surveillance by natural selection (Eickbush and Eickbush, 2007; Ganley and
Kobayashi, 2007). As commented above, this highly contrasts with the L. migratoria
genome where both coding and ITS2 rDNA regions show high levels of homogenization.
Genome size in E. plorans contains about 10 Gb, i.e. almost twice that in L. migratoria
(Ruiz-Ruano et al., 2011). In addition, E. plorans in the Torrox population harbors rDNA
clusters in seven A chromosome pairs (Cabrero et al., 2003) plus the B chromosome
(Cabrero et al., 1999), with about 15,000 rDNA units in the A chromosomes and about
3,000 in the B24 chromosome (Montiel et al., in preparation). In L. migratoria, however,
only three A chromosome pairs carry rDNA (Teruel et al., 2010). Although no
estimation of rDNA copy number has been done in the latter species, the FISH signals
obtained for rDNA in E. plorans are conspicuously larger than those in L. migratoria
(compare Fig. 1a in Teruel et al., 2010 with Fig. 1c in Teruel et al., 2007).
At first sight, it might appear that the fact that the E. plorans genome needs to
homogenize much higher amounts of rDNA units than that in L. migratoria could make
this task more difficult in the former thus justifying its poorer homogenization for the
ITS2 region. Although the fact that another grasshopper species, Stauroderus scalaris,
carries even more rDNA than E. plorans (López-León et al., 1999) in an even larger
genome (15.98 Gb; Belda et al., 1991) but shows an ITS2 rDNA region even more
homogenized than that in L. migratoria (Ruiz-Ruano et al., in preparation) suggests that
there must be other causes than rDNA quantity for the ITS2 variation found in E.
plorans. A possibility is the recent expansion of rDNA through different A
chromosomes across the Mediterranean area (López-León et al., 2008). As these authors
showed, E. plorans populations from the Caucasus (Dagestan) carry rDNA in only two
175
A chromosomes (9 and 11). However, a growing number of A chromosomes harboring
rDNA was observed from east to west: 9, 10 and 11 (Armenia), 1, 9-11 and X (Turkey),
9-11 and X (Greece), 1, 4-11 and X (Spain), and 1-11 and X (Morocco). The analysis of
microdissected A and B chromosomes (Teruel et al., submitted) suggests that, if the
haplotype structuration already existed in rDNA arrays from chromosomes 9 and 11
before intragenomic spread, the rDNA in chromosome 9 appears to have been more
expansive, since this chromosome (along with chromosomes 8, X and B) contained
Hap1, which is the most frequent haplotype in B-lacking individuals from all E. plorans
plorans populations across the Mediterranean region (Ruiz-Ruano et al., in preparation),
whereas chromosome 11 was the only one carrying Hap2. In addition, there was an eastwest gradient for the proportion of rDNA in B chromosomes, with those from the east
being almost exclusively made up of rDNA whereas those from western populations
(Spain and Morocco) also containing high amount of a 180 bp satellite DNA (LópezLeón et al., 2008).
The significant positive correlation found between genome size and the amount
of rDNA in plants and animals (Prokopowich et al., 2003) might suggest some
optimization for both genomic parameters. But a massive intragenomic spread of rDNA,
such as that occurred in E. plorans, could break this relationship impeding efficient
homogenization among non-homologous chromosomes, especially for a genome which,
prior to such spread, only had to homogenize the rDNA units in two non-homologous
chromosomes (9 and 11), a situation appearing to be ancestral in this species since it is
similar in the South African subspecies E. plorans meridionalis (López-León et al.,
2008). The possibility that homogenization between homologous chromosomes works
well in this species is contradicted by the existence of six different haplotypes since, if
chromosomes 9 and 11 would have been properly homologously homogenized, prior to
intragenomic rDNA spread, we would expect a maximum of two different haplotypes,
one coming from chromosome 9 and other from chromosome 11, assuming poor nonhomologous homogenization. Alternatively, this variety of haplotypes could be the
result of population mixture prior to the recent expansion of this species through the
Western Mediterranean area which led to the spread of a same type of B chromosome
(B1), given that this B variant was the ancestor for all B chromosome types found in
Spain, Morocco, Balearic Islands, Tunisia and Sicily (Cabrero et al., 2013). Perhaps a
recent event like this has not provided the genome enough time for an efficient
homogenization. In any case, bearing huge amounts of not completely homogenized
rDNA is not a problem for a genome as long as it is able to select conserved coding
regions for expression, irrespective of whether they are accompanied by ITS2 regions of
one haplotype or another, or even if they are located in a B chromosome.
Acknowledgements
We thank Tatiana López for technical assistance and Karl Meunier for language revision. This
study was supported by grants from the Spanish Ministerio de Ciencia y Tecnología (CGL200911917) and Plan Andaluz de Investigacion (CVI-6649), and was partially performed by FEDER
176
High variable and non-randomly expressed rDNA
funds. M Ruíz-Estévez was supported by a FPU fellowship from the Spanish Ministerio de
Ciencia e Innovación.
References
Alper I, Frenette M, Labrie S (2011) Ribosomal DNA polymorphisms in the yeast
Geotrichum candidum. Fungal Biol 115(12):1259-1269
Belda JE, Cabrero J, Camacho JP, Rufas JS (1991) Role of C-heterochromatin in
variation of nuclear DNA amount in the genus Chorthippus (Orthoptera,
Acrididae). Cytobios 67:13–21
Bragg L, Stone G, Imelfort M, Hugenholtz P, Tyson GW (2012) Fast, accurate errorcorrection of amplicon pyrosequences using Acacia. Nature Methods 9:425–426
doi:10.1038/nmeth.1990
Britten RJ, Kohne DE (1968) Repeated sequences in DNA. Hundreds of thousands of
copies of DNA sequences have been incorporated into the genomes of higher
organisms. Science 161(3841):529-540
Brodin J, Mild M, Hedskog C, Sherwood E, Leitner T, Andersson B, Albert J (2013)
PCR-Induced transitions are the major source of error in cleaned Ultra-Deep
Pyrosequencing
Data.
PLoS
ONE
8(7):
e70388
doi:10.1371/journal.pone.0070388
Brown DD, Wensink PC, Jordan E (1972) A comparison of the ribosomal DNA’s of
Xenopus laevis and Xenopus mulleri: the evolution of tandem genes. J Mol Biol
63:57-73
Cabrero J, López-León MD, Gómez R, Castro AJ, Martín-Alganza A, Camacho JPM
(1997) Geographical distribution of B chromosomes in the grasshopper
Eyprepocnemis plorans, along a river basin, is mainly shaped by non-selective
historical events. Chromosome Res 5:194-198
Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999). Common origin of B
chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity
83:435-439
Cabrero J, Perfectti F, Gómez R, Camacho JPM, López-León MD (2003a) Population
variation in the A chromosome distribution of satellite DNA and ribosomal
DNA in the grasshopper Eyprepocnemis plorans. Chromosome Res 11: 375-381
Dadejová M, Lim KY, Soucková-Skalická K, Matyásek R, Grandbastien MA, Leitch A,
Kovarík A (2007) Transcription activity of rRNA genes correlates with a
tendency towards intergenomic homogenization in Nicotiana allotetraploids.
New Phytologist 174:658-668
Darty K, Denise A, Ponty Y (2009) VARNA: Interactive drawing and editing of the
RNA secondary structure. Bioinformatics 25:1974
Date A, Satta Y, Takahata N, Chigusa SI (1998) Evolutionary history and mechanism of
the Drosophila cecropin gene family. Immunogenetics 47:417-429
Dover GA (1982) Molecular drive: a cohesive mode of species evolution. Nature
299:111–117
Druley TE, Vallania FL, Wegner DJ, Varley KE, Knowles OL, Bonds JA, Robison SW,
Doniger SW, Hamvas A, Cole FS (2009) Quantification of rare allelic variants
from pooled genomic DNA. Nature Methods 6:263-265
Drummond AJ, Ashton B, Cheung M, Heled J, Kearse M (2009) Geneious v4. 8.
Biomatters Ltd., Auckland, New Zealand
Edgar RC, Haas BJ, Clemente JC, Quince C and Knight R.UCHIME improves
177
sensitivity and speed of chimera detection (2011) Bioinformatics 27(16): 2194–
2200. doi:10.1093/bioinformatics/btr381
Eickbush TH, Burke WD, Eickbush DG, Lathe WC (1997) Evolution of R1 and R2 in
the rDNA units of the genus Drosophila. Genetica 100(1-3):49-61
Eickbush TH, Eickbush DG (2007) Finely orchestrated movements: evolution of the
ribosomal RNA genes. Genetics 175(2):477-485
Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: A new series of programs to
perform population genetics analyses under Linux and Windows. Mol Ecol
Resources 10:564–567. doi:10.1111/j.1755-0998.2010.02847.x.
Faircloth BC, Glenn TC (2012) Not all sequence tags are created equal: designing and
validating sequence identification tags robust to indels. PloS One 7:e42543. doi:
10.1371/journal.pone.0042543
Feliner GN, Larena BG, Aguilar JF (2004) Fine-scale geographical structure, intraindividual polymorphism and recombination in nuclear ribosomal internal
transcribed spacers in Armefia (Plumbaginaceae). Ann Bot 93:189-200
Flavell RB, O’Dell M, Thompson WF (1988) Regulation of cytosine methylation in
ribosomal DNA and nucleolus organizer expression in wheat. Journal of
Molecular Biology 204:523-534
Ganley ARD, Kobayashi T (2007) Highly efficient concerted evolution in the ribosomal
DNA repeats: total rDNA repeat variation revealed by whole-genome shotgun
sequence data. Genome Research 17:184-191
Gilles A, Meglécz E, Pech N, Ferreira S, Malausa T, Martin JF (2011) Accuracy and
quality assessment of 454 GS-FLX Titanium pyrosequencing. Bmc Genomics
12:245
Goffeau A, Barrell BG, Bussey H, Davis RW, Dujon B, Feldmann H, Galibert F,
Hoheisel JD, Jacq C, Johnston M, Louis EJ, Mewes HW, Murakami Y,
Philippsen P, Tettelin H, Oliver SG (1996) Life with 6000 genes. Science
274(5287):546:563-7
Gu X, Nei M (1999) Locus specificity of polymorphic alleles and evolution by a birthand-death process in mammalian MHC genes. Mol Biol Evol 16:147-156
Hřibová E, Čížková J, Christelová P, Taudien S, de Langhe E, and Doležel J (2011)
The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and
use
in molecular phylogeny.
PLoS
One
6(3):e17863.
doi:
10.1371/journal.pone.0017863
James SA, O’Kelly MJT, Carter DM, Davey RP, Van Oudenaarden A, Roberts IN
(2009) Repetitive sequence variation and dynamics in the ribosomal DNA array
of Saccharomyces cerevisiae as revealed by whole genome resequencing.
Genome Res 19:626-635
Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Molecular Biology and Evolution
30:772-780
Kautz S, Rubin BE, Russell, JA, Moreau CS (2013) Surveying the microbiome of ants:
Comparing 454 pyrosequencing with traditional methods to uncover bacterial
diversity. Applied and Environmental Microbiology 79:525-534
Keller I, Chintauan-Marquier IC, Veltsos P, Nichols RA (2006) Ribosomal DNA in the
grasshopper Podisma pedestris: escape from concerted evolution. Genetics
174:863-874
Keller I, Veltsos P, Nichols RA (2008) The frequency of rDNA variants within
individuals provides evidence of population history and gene flow across a
grasshopper hybrid zone. Evolution 62:833-844
178
High variable and non-randomly expressed rDNA
Lewis MS, Cheverud JM, Pikaard CS (2004) Evidence for nucleolus organizer regions
as the units of regulation in nucleolar dominance in Arabidopsis thaliana
interecotype hybrids. Genetics 167:931-939
Li Y, Jiao L, Yao YJ (2013) Non-concerted ITS evolution in fungi, as revealed from
the important medicinal fungus Ophiocordyceps sinensis. Mol Phylogenet Evol
68(2):373-379
Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of DNA
polymorphism data. Bioinformatics 25:1451-1452
Lim KY, Kovarik A, Matýăsek R, Bezdĕk M, Lichtenstein CP, Leitch AR (2000) Gene
conversion of ribosomal DNA in Nicotiana tabacum is associated with
undermethylated, decondensed and probably active gene units. Chromosoma
109:161-172
Lidner DL, Carlesen T, Henrik Nilsson R, Davey M, Schumacher T, Kauserud H (2013)
Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in
the internal transcribed spacer rDNA region in fungi. Ecol Evol 3(6):1751-1764
Long EO, David IB (1980) Repeated genes in eukaryotes. Annu Rev Biochem 49:727764
López-León MD, Neves N, Schwarzacher T, Heslop-Harrison TS, Hewitt GM,
Camacho JPM (1994). Possible origin of a B chromosome deduced from its
DNA composition using double FISH technique. Chromosome Res 2:87 -92
López-León MD, Cabrero J, Camacho JPM (1995) Changes in DNA methylation during
development in the B chromosome NOR of the grasshopper Eyprepocnemis
plorans. Heredity 74:296-302
López-León MD, Cabrero J, Camacho JPM (1999) Unusually high amount of inactive
ribosomal DNA in the grasshopper Stauroderus scalaris. Chromosome Res
7:83-88
López-León MD, Cabrero J, Dzyubenko VV., Bugrov AG, Karamysheva TV, Rubtsov
NB, Camacho JPM (2008) Differences in ribosomal DNA distribution on A and
B chromosomes between eastern and western populations of the grasshopper
Eyprepocnemis plorans plorans. Cytogenet Genome Res 121:260-265
Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J,
Braverman MS, Chen YJ, Chen Z (2005) Genome sequencing in
microfabricated high-density picolitre reactors. Nature 437:376-380
Matyášek R, Renny-Byfield S, Fulneček J, Macas J, Grandbastien MA, Nichols
R, Leitch A, Kovařík A (2012) Next generation sequencing analysis reveals a
relationship between rDNA unit diversity and locus number in Nicotiana
diploids. BMC genomics 13:722. doi: 10.1186/1471-2164-13-722
Mayol M, Rosselló JA (2001) Why nuclear ribosomal DNA spacers (ITS) tell different
stories in Quercus. Mol Phylogenet Evol 19:167-176
Meyer F, Paarmann D, D’Souza M, Olson R, Glass EM, Kubal M, Paczian T, Rodriguez
A, Stevens R, Wilke A, et al. (2008) The metagenomics RAST server - a public
resource for the automatic phylogenetic and functional analysis of
metagenomes. BMC Bioinformatics 9:386
Michelmore RW, Meyers BC (1998) Clusters of resistance genes in plants evolve by
divergent selection and a birth-and-death process. Genome Res 8:1113-1130
Musters W, Boon K, Van der Sande CA, Van Heerikhuizen H, Planta RJ (1990)
Functional analysis of transcribed spacers of yeast ribosomal DNA. The EMBO
journal 9:3989
Nei M, Hughes AL (1992) in 11th Histocompatibility Workshop and Conference, eds.
Tsuji K, Aizawa M and Sasazuki T (Oxford Univ. Press, Oxford), Vol. 2, pp:27-
179
38
Nei M, Gu X, Sitnikova T (1997) Evolution by the birth-and-death process in multigene
families of the vertebrate immune system. Proc Natl Acad Sci USA
94(15):7799-780
Nei M, Rogozin IB, and Piontkivska H (2000) Purifying selection and birth-and-death
evolution in the ubiquitin gene family. Proc Natl Acad Sci USA 97(20):1086610871
Niklas N, Pröll J, Danzer M, Stabentheiner S, Hofer K, Gabriel C (2013) Routine
performance and errors of 454 HLA exon sequencing in diagnostics. BMC
Bioinformatics 14:176
Ota T, Nei M (1994) Divergent evolution and evolution by the birth-and-death process
in the immunoglobulin VH gene family.Mol Biol Evol 11(3):469-482
Pilotti M, Brunetti B, Tizzani L (2009) Platanus×acerifolia genotypes surviving to
inoculation with Ceratocystis platani (the agent of canker stain): first screening
and molecular characterization. Euphytica 169:1-7
Prokopowich CD, Gregory TR, Crease TJ (2000) The correlation between rDNA copy
number and genome size in eukaryotes. Genome 46:48-50
Reeder RH (1999) Regulation of RNA polymerase I transcription in yeast and
vertebrates. Prog Nucleic Acid Res Mol Biol 62:193-327
Rice P, Longden I, Bleasby A (2000). EMBOSS: the European molecular biology open
software suite. Trends in Genetics 16:276-277
Rooney AP, Piontkivska H, Nei M (2002) Molecular evolution of the nontandemly
repeated
genes
of
the
histone
3
multigene
family.
Mol Bio and Evo 19(1):68-75
Rooney AP, Ward TJ (2005) Evolution of a large ribosomal RNA multigene family in
filamentous fungi: Birth and death of a concerted evolution paradigm. Proc Natl
Acad Sci 102:5084-5089
Rufas JS, Iturra P, de Souza W, Esponda P (1982) Simple silver staining procedure for
the localization of nucleolus and nucleolar organizer under light and electron
microscopy. Arch Biol 93:267-274
Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2012) B-Chromosome
Ribosomal DNA is functional in the grasshopper Eyprepocnemis plorans. PLoS
ONE 7(5): e36600. doi:10.1371/journal.pone.0036600
Ruiz-Estévez M, López-León MD, Cabrero J, Camacho JPM (2013) Ribosomal DNA is
active in different B chromosome variants of the grasshopper Eyprepocnemis
plorans. Genetica 141:337-345
Ruiz-Ruano FJ, Ruiz-Estévez M, Rodríguez-Pérez J, López-Pino JL, Cabrero J,
Camacho JPM, (2011) DNA amount of X and B chromosomes in the
grasshoppers Eyprepocnemis plorans and Locusta migratoria. Cytogenet
genome Res 134:120-126
Simon UK, Weiss M (2008) Intragenomic variation of fungal ribosomal genes is higher
than previously thought. Mol Biol Evol 25(11):2251-2254
Sitnikova T, Nei M (1998) Evolution of immunoglobulin kappa chain variable region
genes in vertebrates. Mol Biol Evol 15(1):50-60
Sogin ML, Morrison HG, Huber JA, Welch DM, Huse SM, Neal PR, Arrieta JM, Herndl
GJ (2006) Microbial diversity in the deep sea and the underexplored “rare
biosphere”. Proc Natl Acad Sci USA 103:12115-12120
Song HX, Gao SP, Jiang MY, Liu GL, Yu XF, Chen QB (2012) The evolution and utility
of ribosomal ITS sequences in Bambusinae and related species: divergence,
pseudogenes, and implications for phylogeny. J Genet 91:129-139
180
High variable and non-randomly expressed rDNA
Stage DE, Eickbush TH (2007) Sequence variation within the rRNA gene loci of 12
Drosophila species. Genome Res 17(12):1888-1897
StatSoft, Inc. (2007) STATISTICA (data analysis software system), version 8.0.
www.statsoft.com
Stewart FJ, Cavanaugh CM (2007) Intragenomic variation and evolution of the internal
transcribed spacer of the rRNA operon in bacteria. J Mol Evol 65(1):44-67
Teacher AGF, Griffiths DJ (2011) HapStar: Automated haplotype network layout and
visualisation. Mol Ecol Res 11:151-153
Tedersoo L, Nilsson RH, Abarenkov K, Jairus T, Sadam A, Saar I, Bahram M, Bechem
E, Chuyong G, Kõljalg U (2010) 454 Pyrosequencing and Sanger sequencing of
tropical mycorrhizal fungi provide similar results but reveal substantial
methodological biases. New Phytologist 188:291-301
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during
meiosis and NOR activity of a B chromosome in the grasshopper
Eyprepocnemis plorans. Chromosome Res 15:755–765
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR
expression in a B chromosome of the grasshopper Eyprepocnemis plorans.
Chromosoma 118:291–301
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromosome ancestry
revealed by histone genes in the migratory locust. Chromosoma 119: 217–225
Van der Sande CA, Kwa M, van Nues RW, van Heerikhuizen H, Raué HA, Planta RJ
(1992) Functional analysis of internal transcribed spacer 2 of Saccharomyces
cerevisiae ribosomal DNA. Journal of molecular biology 223:899-910
Van Tassell CP, Smith TP, Matukumalli LK, Taylor JF, Schnabel RD, Lawley CT,
Haudenschild CD, Moore SS, Warren WC, Sonstegard TS (2008) SNP
discovery and allele frequency estimation by deep sequencing of reduced
representation libraries. Nature Methods 5:247-252
Veltsos P, Keller I, Nichols RA (2009) Geographically localised bursts of ribosomal
DNA mobility in the grasshopper Podisma pedestris. Heredity 103:54-61
Vydryakova GA, Van DT, Shoukouhi P, Psurtseva NV, Bissett J (2012) Intergenomic
and intragenomic ITS sequence heterogeneity in Neonothopanus nambi
(Agaricales) from Vietnam. Mycology 3:89-99
Wang T, Pradhan K, Ye K, Wong LJ, Rohan TE (2011) Estimating allele frequency from
next-generation sequencing of pooled mitochondrial DNA samples. Front Genet
2:51
Wörheide G, Nichols SA, Goldberg J (2004) Intragenomic variation of the
rDNA internal transcribed spacers in sponges (Phylum Porifera): implications
for phylogenetic studies. Mol Phylogenet Evol 33(3):816-830
Zavodna M, Grueber CE, Gemmell NJ (2013) Parallel Tagged Next-Generation
Sequencing on Pooled Samples–A New Approach for Population Genetics in
Ecology
and
Conservation.
PloS
One
8:e61471.
doi:
10.1371/journal.pone.0061471
Zimmer EA, Martin SL, Beverley SM, Kan YW, Wilson, AC (1980) Rapid duplication
and loss of genes coding for the alpha chains of hemoglobin. Proc Natl Acad Sci
USA 77: 2158-2162
Zhan J, Dyer KD, Rosenberg HF (2000) Evolution of the rodent eosinophil associated
RNase gene family by rapid gene sorting and positive selection. Proc Natl Acad
Sci USA 97:4701–4706
Zhou J, Eickbush MT, Eickbush TH (2013) A Population Genetic Model for the
Maintenance of R2 Retrotransposons in rRNA Gene Loci. PLoS Genet
181
9(1):e1003179. doi:10.1371/journal.pgen.1003179
Zuker M (2003) Mfold web server for nucleic acid folding and hybridization
prediction. Nucleic Acids Research 31:3406-3415
Supporting Information
Table S1 Sequence and edit distances of the six tags of the ITS2 primers.
Tag
Sequence
Distance
1
AACAGC
5
2
AGGCTA
5
3
CCATTG
5
4
CTCGAA
5
5
TGTACG
5
6
AGAATA
4
Table S2 Tag combinations of the primers used to amplify each sample in the
comparison between individuals (F: forward; R: reverse).
gDNA
cDNA
Male Nº B
F
R
F
R
51
0
6
5
2
3
53
0
1
6
2
4
57
0
2
6
2
5
65
0
6
3
2
1
70
0
3
6
4
3
80
0
6
4
2
2
49
1
5
5
1
4
54
1
5
3
1
2
24
1
3
4
5
1
44
1
4
6
3
1
46
1
5
6
3
2
48
1
6
6
3
3
66
1
4
2
3
5
69
1
4
4
4
5
55
2
5
4
1
3
63
2
6
2
4
1
62
3
6
1
1
5
50
3
5
2
1
1
182
High variable and non-randomly expressed rDNA
Table S3 Tag combinations of the primers used to amplify each sample in the
comparison between body parts (F: forward; R: reverse).
0B
Source
gDNA
cDNA
Body part
Head
Hind leg
Wing muscle
Testis
Accessory gland
Caecum
Head
Hind leg
F
1
1
1
1
1
5
2
2
R
1
2
3
4
5
1
1
2
Wing muscle
Testis
2
2
3
4
Accessory gland
Caecum
2
5
5
2
Table S4 Factor Analysis performed with the read counts
for the six ITS2 haplotypes found in the gDNA of
E.plorans males. (Expl. Var= Explained variance; Prp.
Totl= Proportion of total variance).
gHap2
-0.048614
-0.911316
gHap3
0.193937
-0.950261
gHap4
-0.265602
-0.875889
gHap5
-0.578536
0.491940
gHap6
0.030487
-0.950417
Expl.Var
3.949.135
1.103.900
Prp.Totl
0.658189
0.183983
183
F a cto r L o a d in g s, F a cto r 1 vs. F a cto r 2
R o ta tio n : U n r o ta te d
E xtr a ctio n : P r in cip a l co m p o n e n ts
0 ,6
gH ap5
0 ,4
0 ,2
gH ap3
gH ap6
Fa cto r 2
0 ,0
- 0 ,2
gH ap2
gH ap1
- 0 ,4
- 0 ,6
- 0 ,8
- 1 ,0
- 1 ,0
gH ap4
- 0 ,9
- 0 ,8
- 0 ,7
- 0 ,6
- 0 ,5
- 0 ,4
- 0 ,3
- 0 ,2
F a cto r 1
Fig. S1 The graph shows the position of the five ITS2 haplotypes found in the gDNA
(gHap) of E.plorans, according to the two factors obtained after the Factor Analysis.
184
Capítulo 9. Discusión general
185
186
Discusión general
Discusión general
El objetivo de esta Tesis Doctoral es averiguar si la secuencia del ADN ribosómico
(ADNr) que albergan los cromosomas B del saltamontes Eyprepocnemis plorans
permite diferenciarlo del localizado en los cromosomas A y, en ese caso, averiguar si el
ADNr del B es funcional, en qué grado y en qué partes del cuerpo se expresa, así como
el significado biológico de los transcritos de ARNr que aportan los cromosomas B.
Dado el importante papel de la expresión del ADNr (ARNr) en la síntesis de
ribosomas y, por tanto, de proteínas (Sollner-Webb y Tower, 1986) y teniendo en
cuenta los resultados previos obtenidos por Teruel y col. (2007, 2009) en los que ponían
de manifiesto la activación de la NOR del cromosoma B 24, nos propusimos ampliar este
estudio en machos del año 2008 de la misma población, y hacerlo no sólo al nivel
citogenético sino también al molecular. En el análisis citogenético mediante
impregnación argéntica encontramos que el porcentaje de machos portadores de B con
su NOR activa no había cambiado desde 2004, siendo del 50%, y en ellos tampoco
había variado desde 1999 el porcentaje de células con la NOR del B activa,
(aproximadamente 20%) aunque existían diferencias entre machos. Esto sugiere que la
activación del ADNr del B no es un hecho aleatorio, sino que debe estar regulado a
nivel de individuo y de célula. A nivel molecular, la comparación de secuencias de
ADNr procedentes de diferentes cromosomas microdiseccionados de Eyprepocnemis
plorans de Torrox obtenidas por Teruel (2009) permitió detectar la inserción diferencial
de un adenina en las secuencias ITS2 del cromosoma B. Tras diseñar los primers para
detectar los transcritos ARNr que provenían específicamente del B, a los que hemos
denominado ITS2_B, detectamos estos transcritos propios del B en 18 de los 19 machos
en los que citogenéticamente habíamos observado la NOR del B activa. El hecho de que
no los detectáramos en la totalidad de machos analizados puede deberse a que el nivel
de expresión de la NOR es tan bajo que hace improbable la detección de los transcritos
ITS2_B, o también al hecho de que el nucleolo se visualiza en diplotene/paquitene pero
su activación tuvo lugar previamente en leptonene/citogene, con lo que los transcritos
ARNr del B pueden haberse degradado aunque el macho muestre nucleolo. Por otra
parte, en 13 de los 15 machos analizados con la NOR del B inactiva no detectamos
transcritos del B, pudiéndose explicar estas dos excepciones por una disociación
temprana del nucleolo en diplotene, o bien por la existecia de un umbral en la técnica de
impregnación argéntica por debajo del cual no se tiñen los nucleolos, no siendo posible
visualizalos aunque el ADNr del B estuviera activo en ambos casos. En cualquier caso,
las excepciones encontradas también pueden deberse a que el estudio citogenético se
hizo en testículo mientras que el análisis molecular se llevó a cabo en una muestra
compuesta por una mezcla de tejidos del cuerpo entero, a excepción del testículo que se
utilizó exclusivamente para los estudios citogenéticos.
En general, existe una gran correspondencia entre la visualización del nucleolo
del B y la expresión de su ADNr, por lo que este estudio nos permitió desarrollar una
herramienta para detectar molecularmente la activación del ADNr del B. El uso de esta
187
aproximación molecular permite eliminar la duda de si el nucleolo que observamos en
el B es propiamente suyo o por el contrario está reclutando material nucleolar de otras
NORs. El desarrollo de esta estrategia es muy interesante ya que también nos ha
permitido analizar la expresión del ADNr del B en hembras, un material donde es difícil
encontrar en las gónadas células en división meiótica y más aún encontrar células en
profase I donde sea posible visualizar nucleolos. Así, detectamos transcritos de ARNr
del B en 10 de las 13 hembras analizadas, y dada la alta correspondencia
citogenética/molecular observada en los machos, podemos inferir que el ADNr del B
está activo en mayor proporción en las hembras.
Los transcritos de ARNr del B podrían tener una función importante en la
organización y/o regulación de los propios Bs (Carchilan y col. 2007; Han y col. 2007).
En E. plorans los transcritos de ARNr del B son importantes, además, para garantizar la
demanda de rRNA celular ya que se ha observado en la población de Torrox que el área
nucleolar total de la célula no depende del nivel de actividad en la NOR del B24, de
forma que si aumenta la actividad de la NOR del B, disminuye la de los As y viceversa
(Teruel y col. 2007, 2009), lo que indicaba que los transcritos ARNr del B son
funcionales como finalmente hemos demostrado en esta tesis. Ide y col. (2010)
demostraron en sus estudios en levaduras que la baja sensibilidad al daño del ADN en
las cepas con gran número de copias de ADNr depende de la baja tasa de transcripción
de los genes de ARNr. Según esto, la regulación del área nucleolar total observada en E.
plorans sería un mecanismo llevado a cabo por los As para proteger al genoma frente a
agentes dañinos y así no ver disminuida su eficacia biológica.
La reciente activación de la NOR del B24 recuerda al fenómeno de dominancia
nucleolar (Pikaard, 2000a, 2000b) que se da sobre todo en híbridos, en el cual el ADNr
de uno de los parentales permanece activo mientras el otro es inactivado. Este fenómeno
es reversible, con lo que el ADNr inactivo puede reactivarse bajo ciertas circunstancias
como alto requerimiento de síntesis proteica (Chen y Pikaard, 1997). Esta
activación/inactivación se debe a patrones de metilación del ADN o acetilación de
histonas, hechos que se han observado en los Bs de E. plorans, ya que Cabrero y col.
(1987) y López-León y col. (1991) demostraron la actividad NOR e hipometilación de
un B2 que estaba fusionado a un autosoma, y Cabrero y col. (2007) demostraron la
hipoacetilación de las histonas H3 en Bs inactivos.
En E. plorans se han descrito más de 50 variantes de cromosomas B (HenriquesGil y col. 1984; López-León y col. 1993; Bakkali y col. 1999; Abdelaziz y col. 2007;
López-León y col. 2008) que derivan unas de otras debido al alto grado de mutaciones
que muestran estos cromosomas, lo que les abre nuevos caminos evolutivos. HenriquesGil y col. (1984) y Henriques-Gil y Arana (1990) sugirieron que el B 1 era la variante
ancestral en la Península Ibérica, ya que la encontraron en todas las poblaciones
analizadas a excepción de las de Granada y las del oeste de Málaga, donde fue
reemplazada por B2, y en Fuengirola, donde fue reemplazada por B 5.
Tras analizar mediante FISH la composición en ADNr y ADNsatélite (ADNsat)
de los cromosomas B de diferentes poblaciones del Mediterráneo occidental, tales como
188
Discusión general
Sicilia, Túnez y 15 poblaciones españolas, encontramos 4 variantes: B1, B2, B5 y B24
formadas mayoritariamente por estos dos tipos de secuencias pero con distinta
proporción de ellas, y distinto tamaño relativo respecto al cromosoma X. Esto sugiere
que diferentes mutaciones cromosómicas han producido amplificaciónes y deleciones
de estas secuencias creando variantes nuevas de B, como ha ocurrido con B5 y B24 . En
las variantes B1 y B2, las diferencias en composición y tamaño se ponen de manifiesto
incluso en la misma variante en dos poblaciones diferentes, un hecho lógico si tenemos
en cuenta que son más antiguas que B 5 y B 24 con lo que han tenido más tiempo de
acumular pequeños cambios.
La determinación de qué variante tiene cada población, nos permitió hacer
algunas inferencias respecto a cuál fue la variante B ancestral y cuándo apareció. El B1
está en toda la región mediterránea occidental (Sicilia, Túnez, Islas Baleares y Península
Ibérica) y también se ha encontrado en Marruecos (Cabrero y col. 1999), por lo que es
la variante de B más ampliamente distribuida en esta región. Se la considera la variante
ancestral en la Península Ibérica porque es la más representada (Henriques-Gil y col.
1984; Henriques-Gil y Arana, 1990), pero tras encontrarla también en poblaciones
distantes de Sicilia y Túnez se puede considerar además que B 1 es la variante ancestral
de todo el oeste mediterráneo. Sin embargo, los Bs analizados en zonas del
mediterráneo oriental, como Grecia y Turquía (Abdelaziz y col. 2007; López-León y
col. 2008) tienen mayores proporciones de ADNr que B1, por lo que constituyen tipos
de B diferentes a los analizados en el presente estudio.
Los Bs del mediterráneo occidental y oriental son de reciente aparición (MuñozPajares y col. 2011) ya que: 1) muestran muy poca variación para la región de 1510 pb
del SCAR (otro marcador molecular del B), 2) hay poblaciones del interior de la
Península aisladas por barreras geográficas, como en la cabecera del Río Segura, que no
tienen B (Cabrero y col. 1997; Manrique-Poyato y col. en preparación), 3) la población
de Otívar que se localiza a 10 km de la costa ha sido colonizada por Bs en los últimos
35 años (Camacho y col. presentado). Si hemos podido observar en cortos periodos de
tiempo cómo el B coloniza nuevas regiones, podría ser que su origen lo pudiéramos
medir en términos de tiempo histórico reciente. Este dato viene apoyado por el hecho de
que E .plorans se encuentra muy frecuente en los cultivos, pudiendo ser transportado
fácil y rápidamente en las plantas que son llevadas por los seres humanos de unas
regiones a otras por intereses comerciales (Cabrero y Camacho, observación personal).
Si fuera cierto que el B se originó recientemente deberíamos esperar que todas
las variantes expresaran su ADNr (y no sólo el B24, como hemos visto), ya que no habría
habido suficiente tiempo para que ocurrieran mutaciones que inactivaran los Bs. El
análisis citogenético y molecular de la expresión del ADNr de B1 , B2, B5 y B24 en 11
poblaciones españolas (Nerja, Torrox, Fuengirola, S’Esgleieta, Algarrobo, Salobreña,
Cieza, San Juan, Mundo, S’Albufereta y Otívar) reveló que dicha actividad no estaba
restringida a la variante B24 ni a la población de Torrox, ya que encontramos actividad
también en el B1 y B2 y en diferentes poblaciones, pero no en la B5 presente sólo en
Fuengirola. Esto sugiere que la actividad de la B-NOR debe ser una condición ancestral,
puesto que es compartida por varias variantes. Además, el hecho de que la variante
189
considerada ancestral B1 exprese la NOR la reafirma en su condición de variante
original de B.
En este análisis encontramos, además, que existe un umbral del 10% de
diplotenes con B-NOR activa para que puedan detectarse molecularmente transcritos del
ADNr del B. Esta detección es independiente del tamaño del nucleolo del B que suele
ser aproximadamente la mitad del área del cromosoma X. Sin embargo, la proporción
de machos con la NOR del B activa era muy variable entre poblaciones (0-28’57%) y
mucho menor que la anteriormente descrita para Torrox en 2008 (48%), lo que sugiere
que la mayoría de los Bs tienen la NOR silenciada y sólo muestran actividad
esporádicamente. De hecho, en la población de Nerja, localizada a tan sólo 8 km de
Torrox, no hemos detectado actividad de la NOR de su B2, un hecho que evidencia que
la misma variante puede estar activa en unas poblaciones (incluso mostrando diferentes
grados de expresión) e inactiva en otras. Como comentamos anteriormente para el caso
de Torrox, estas diferencias se deben principalmente a fenómenos de metilación del
ADN y/o acetilación de histonas. Otra circunstancia que explicaría los diferentes
estados de actividad de la NOR del B de sería el nivel de ocupación del ADNr del B por
transposones con diana en esa secuencia como son el R1, R2 o Pokey (Eickbush 2002;
Penton y col. 2002), que pueden llegar a inhibir o potenciar la transcripción del ADNr.
Así, el cromosoma B24 tiene mayor cantidad de R2 en su ADNr que su antecesor, el B2
(Montiel y col. en preparación), y son los bloques de ADNr más largos y libres de R2
los que preferencialmente se expresan (Eickbush y col. 2008; Zhou y Eickbush, 2009).
La mayor expresión detectada en B24 respecto a B2 podría ser debido a un mayor
agrupamiento de R2 en B24, y esto deja más copias de ADNr libres de R2, que son más
proclives a expresarse. Alternativamente, no se puede descartar que R2 tenga algo que
ver con la mayor expresión de este cromosoma B (Montiel y col. en preparación). Las
diferencias en expresión entre variantes de B también podrían deberse a cambios
estructurales, como ocurrió con la fusión de B2 con el autosoma de mayor tamaño que
condujo a la activación de la NOR del B (Cabrero y col. 1987). Finalmente, la mayor
expresión de B24 también podría estar asociada a la disminución del número de copias
con respecto a su antecesor B2, ya que, como sugirieron Ide y col. (2010), en levaduras
las cepas con menos repeticiones de ADNr son los que muestran una mayor tasa de
transcripción del mismo.
Al igual que ocurría en el primer experimento de expresión, hay casos donde
vemos actividad de la NOR del B pero no detectamos transcritos o viceversa, y podría
deberse a que, como explicamos anteriormente, los experimentos citogenéticos y
moleculares no fueron realizados en las mismas partes corporales. Esta observación
requería que analizáramos la expresión del ADNr del B en diferentes partes del cuerpo,
para lo cual tuvimos primero que averiguar si el B estaba presente en las diferentes
partes del cuerpo. Lo que se sabía hasta ahora era que el B era mitóticamente estable en
partes del cuerpo del mismo individuo donde se podían visualizar cromosomas como el
testículo, la ovariola y el ciego gástrico (Camacho y col. 1980; Henriques-Gil y col.
1986), pero nada se sabía sobre qué ocurría en el resto de partes del cuerpo sin división
celular activa. Tras detectar los marcadores específicos del B (SCAR e ITS2_B) en ocho
190
Discusión general
partes del cuerpo con tejidos somáticos (antena, cabeza, ganglio cerebral, pata saltadora,
músculo alar, ciego gástrico, túbulos de Malphigi y la glándula accesoria en machos), en
la ovariola en hembras y en el testículo de machos portadores de B pudimos concluir
que los Bs están presentes en todas las partes del cuerpo, al menos en los aquí
analizados. Así mismo, no detectamos amplificación en partes corporales de individuos
sin B. Esto sugiere que los cromosomas B en E. plorans no son eliminados de ningún
tejido somático, comportándose de manera regular durante las mitosis que conducen al
desarrollo de los individuos.
Una vez que comprobamos que el cromosoma B estaba presente en las células
de todas las partes del cuerpo analizadas en los individuos, pudimos estudiar
molecularmente la expresión del ADNr del cromosoma B24 en las diferentes partes del
cuerpo de varios machos en los que habíamos detectado citogenéticamente la B-NOR
activa en las gónadas. La amplificación de qITS2_B (una versión más corta de la
secuencia específica del B, ITS2_B) mediante qRT-PCR en cabeza, pata saltadora,
músculo alar, testículo, glándula accesoria y ciego gástrico fue positiva en todos los
casos, poniendo de manifiesto que la transcripción del ADNr del B no está restringida a
la gónada. Además, dicha expresión era diferencial, siendo mayor en testículo, glándula
accesoria y músculo alar, y podría deberse a cambios estructurales o a cambios
epigenéticos. En el primer caso, la amplificación diferencial del ADNr conllevaría un
aumento del número de copias y la expresión podría depender de su abundancia
(Subrahmanyam y col. 1994; Ide y col. 2010), pero este hecho no ocurre en E. plorans
(ver discusión más adelante). Sin embargo, los cambios epigenéticos sí podrían ser los
responsables de las diferencias de expresión encontradas ya que en E. plorans se han
detectado marcas epigenéticas en los B asociadas a la actividad de su ADNr (Cabrero y
col. 1987; López-León y col. 1991), como hemos comentado anteriormente. Y está
establecido que la metilación del ADN y la acetilación de histonas están implicadas en
la expresión de genes específicos de tejidos y de ciertos factores de transcripción
específicos de célula/tejido (Shen y Maniatis, 1980; Cho y col. 2001; Imamura y col.
2001; Hattori y col. 2004b, 2007; Nishino y col. 2004) de forma que cada tejido tiene su
propio patrón de metilación asociado a su función (Ohgane y col. 1998; Shiota y col.
2002; Strichman-Almashanu y col. 2002), y las modificaciones de histonas influyen en
la interacción entre factores de transcripción y cromatina (Ruthenburg y col. 2007). .
La expresión diferencial del ADNr del B sugiere que existen diferencias en los
requerimientos energéticos entre partes del cuerpo de E. plorans, al menos en el
momento en que fueron congelados y que, frente a una fuerte demanda de síntesis
proteica, los transcritos aportados por el B pueden ser utilizados. El significado
biológico de estos transcritos, una vez que sabemos que son funcionales (ver discusión
más adelante) dependerá de la proporción que representen en el total de transcritos de la
célula, sin olvidar que en testículos, al menos, el área nucleolar total celular está
regulada (Teruel y col. 2007, 2009), lo que sugiere que la demanda total de ARNr de la
célula también lo está. Esta proporción no debe ser muy alta, porque lo analizado hasta
ahora concluye que no más del 50% de los machos portan una B-NOR activa y, dentro
191
de ellos, la proporción de células con B-NOR activas no supera el 29% en ninguna de
las 11 poblaciones analizadas (Teruel y col. 2007, 2009).
Esta expresión diferencial del ADNr del B en E. plorans también puede ser
discutida en términos de un sistema de hospedador-parásito. Como los transcritos del B
son funcionales, podría parecer que su parasitismo ejercido sobre el individuo está
disminuyendo, pero nada más lejos de la realidad si tenemos en cuenta que su ADNr se
transcribe más activamente en partes del cuerpo relacionadas con la reproducción y la
supervivencia. El B, como parásito vertical obligado, tiene su eficacia biológica
asociada a la de su hospedador (Muñoz y col. 1998), por lo que si contribuye aportando
transcritos de ARNr en partes del cuerpo importantes para la reproducción y la
supervivencia estará, en última instancia, beneficiándose a sí mismo.
La heterocromatina que constituye los cromosomas B es constitutiva, al igual
que la de las regiones pericentroméricas de los cromosomas A y una proteína
típicamente asociada a la heterocromatina es la HP1 (Heterochromatin Protein 1). Tras
forzar la disminución de los niveles de transcripción del gen para la HP1α mediante
ARNi (ARN interferencia) obtuvimos una gran variedad de efectos moleculares,
fisiológicos y fenotípicos, dependientes del estado del ciclo celular en el que se
encontrara la célula cuando fue afectada por dicha disminución. Esta variedad de
efectos se debe a que la proteína HP1α está principalmente localizada en la
heterocromatina centromérica, aunque también asociada a la eucromatina (Piacentini y
col. 2009), lo que hace que sea un gen de amplia actuación en el genoma. El patrón de
condensación anormal que encontramos debido a la disminución de HP1α, en el cual se
afectaba tanto las heterocromatinas constitutiva y facultativa como la eucromatina,
demuestra el importante papel que tiene esta proteína en el ensamblaje de la cromatina
(Eissenberg y Elgin, 2000). Aún así, en los machos experimentales quedó una región
pericentromérica condensada, seguramente debido a la protección que confieren las
proteínas centroméricas. Estos efectos sobre la condensación cromatínica pueden ser
debido a que los bajos niveles de HP1α interrumpieran la condensación en la profase
meiótica I o a un fallo en el mantenimiento de dicha condensación. Otro de los efectos
que encontramos en los machos donde hemos disminuido HP1α es la aparición de
puentes cromosómicos, los cuales producen fallos en la segregación de cromosomas
homólogos dando lugar al gran número de células poliploides (macroespermátidas) que
observamos. Estos puentes pueden resultar de: 1) fusiones teloméricas debido al
descenso de los niveles de HP1α (Fanti y col. 1998), 2) desregulación de genes
relacionados con los telómeros como Bub1 (Basu y col. 1999), 3) pérdida de interacción
entre HP1α y los telómeros, ya que HP1 forma parte de telómeros y centrómeros donde
controla la elongación y el comportamiento del primero (Fanti y col. 1998; Savitsky y
col. 2002; Sharma y col. 2003). En los machos de E. plorans donde hemos disminuido
la transcripción de HP1α no observamos una pérdida de telómeros pero sí una
disminución de la transcripción del gen Bub1 (De Lucia y col. 2005), por lo que las
explicaciones 2) y 3) son las más probables para el efecto observado en nuestra especie.
Sin embargo, nuestros resultados en E. plorans no evidencian cambios en la expresión
de los genes de ARNr y Hsp70 tras disminuir HP1α, un hecho corroborado por la
192
Discusión general
ausencia de cambios en la expresión de las NORs (incluida la del B, inactiva) y en el
área nucleolar total. Esto se debe a que los efectos de HP1 pueden ser dependientes de
especie (Serrano y col. 2009; Lee y col. 2013), ya que en ratones existe relación directa
entre las disminuciones de HP1 y de los genes ARNr (Horáková y col. 2010), mientras
que en Drosophila la relación es inversa (Larson y col. 2012). En E.. plorans podría
estar aumentando la expresión del ARNr en los machos experimentales, pero no la
detectamos porque, quizás, está siendo contrarrestada por el envejecimiento producido
por la disminución de HP1 y otros cambios de expresión génica que también puedan
interferir. Sin embargo, sí se detectaron en los machos experimentales varios efectos a
nivel fisiológico tales como la disminución de movilidad y vitalidad, de masa muscular,
de hemolinfa, de divisiones celulares y de la superviviencia, produciendo la muerte de
los individuos. Estos cambios son atribuibles a la disminución de HP1, ya que ésta
produce letalidad en Drosophila (Liu y col. 2005) y formación anormal del músculo en
ratones (Sdek y col. 2013). Además, la heterocromatina es muy importante para
conservar la integridad del músculo y así mantener la vida, ya que la pérdida de
músculo (sarcopenia) es la principal causa de muerte en los individuos con más edad de
Drosophila y Caenorhabditits elegans (Larson y col. 2012; Herndon y col. 2002).
Continuando con el análisis de la estructura de los cromosomas B, nos
propusimos analizar ésta a mayor profundidad cuantificando el número de copias de
ADNr específico del B en un intento de desarrollar un método molecular para elucidar
el número de cromosomas B que tenía un individuo. Este análisis puso de manifiesto la
gran variación existente para el número de copias de B-ADNr entre individuos
portadores de B, no sólo entre variantes de B, como era de esperar, sino también para
una misma variante de B en los diferentes individuos de una misma población. Esto
impidió utilizar esta metodología para el fin propuesto, ya que B24 mostró tener entre
208 y 3970 copias, en diferentes individuos, mientras que B2 mostró entre 4818 y 13658
copias. Las diferencias entre las dos variantes son lógicas si tenemos en cuenta que la
primera surgió a partir de la segunda mediante mutaciones que implicaron ganancia de
ADNsat y la pérdida de ADNr (Henriques-Gil and Arana 1990; Zurita et al 1998;
Cabrero et al 1999). Además, detectamos algunas copias específicas del B en individuos
sin B y podría ser debido a que están albergadas en el/los cromosoma(s) antecesores del
B, aunque estas copias no se están transcribiendo pues no las hemos detectado en
ningún experimento de expresión de los realizados con individuos 0B. La variabilidad
que hemos detectado para el número de copias de ADNr del B, incluso dentro del
mismo tipo, podría haberse originado por entrecruzamiento desigual o amplificación
diferencial del ADNr. El primer caso sería el más probable en E.plorans, ya que se ha
observado que los Bs forman quiasmas entre ellos cuando hay dos o más en la misma
célula meiótica, preferentemente en dos posiciones, una intersticial en la que está
implicado el ADNsat y otra distal que involucra al ADNr (Henriques-Gil y col. 1984;
López-León y col. 1994, 1995). La variabilidad para el número de copias de ADNr del
B fue además corroborada por FISH al poner de manifiesto diferencias en el tamaño de
la banda de ADNr de los Bs pertenecientes incluso a la misma población.
193
Sin embargo, cuando comparamos el número de copias de ADNr de B 24 entre
partes del cuerpo no detectamos diferencias significativas, contrariamente a las
observaciones de Fox (1970) que sugerían una replicación diferencial del ADN nuclear
entre diferentes tejidos de Schistocerca gregaria y Locusta migratoria, o a otros casos
de plantas con número variable de copias de genes ribosómicos entre tejidos del mismo
individuo (Rogers y Bendich, 1989). La variación encontrada entre individuos pero no
entre partes del cuerpo sugiere que ésta debe estar relacionada con la meiosis y no con
la mitosis, puesto que en partes del cuerpo con tejidos somáticos donde hay división
mitótica no hay variación. A pesar de no existir variación para el número de copias de
ADNr del B entre partes corporales, sí sabemos que esta secuencia se expresa
diferencialmente en partes del cuerpo relacionadas con la reproducción y la
supervivencia, como hemos comentado anteriormente. Al igual que la regulación de la
activación de las NORs es muy estricta, manteniendo constante el área nucleolar total de
la célula (Teruel y col. 2007, 2009), la expresión del ADNr del B también debe estar
bien regulada en la célula, ya que ésta sólo transcribe habitualmente una parte de los
genes para ARNr que tienen los genomas (Reeder, 1999).
Hasta ahora, muchos de los resultados de la presente Tesis Doctoral se han
obtenido a través del uso de una región diferencial del ITS2 del ADNr del B como
marcador molecular de dicho cromosoma. Por ello, tras varios experimentos previos con
Locusta migratoria y otros machos de E. plorans, realizamos dos experimentos para
caracterizar, mediante “454 amplicon sequencing”, la variabilidad existente en la región
ITS2 del ADNr, tanto en ADNg (ADN genómico) como en ADNc (ADN
complementario) de diferentes partes corporales de un macho 0B, así como de 18
machos con diferente número de B (0-3) capturados en la población de Torrox. Esta
nueva tecnología introduce errores en las secuencias que están siendo secuenciadas,
tanto durante la PCR previa como en la secuenciación per se (Gilles y col. 2011; Brodin
y col. 2013; Niklas y col. 2013), y es uno de los principales temas de controversia al
analizar este tipo de datos, ya que aún no hay un método para eliminar errores con plena
confianza. Por este motivo, nuestro experimento llevaba un control interno que nos
permitió estimar la tasa de error: a ambos lados de la secuencia ITS2 había un total de
123 nucleótidos que formaban parte del gen 5,8S y del 28S. Dado que esta secuencia
codificadora está muy conservada en los saltamontes acrídidos (Ruiz-Ruano y col. en
preparación), podemos asumir que toda la variación que encontremos en esos 123
nucleótidos será debida a errores de secuenciación. Aunque es muy probable que esta
estima sea por exceso, eso nos garantiza la eliminación de falsos positivos en la muestra
de secuencias. Las tasas de error estimadas en los experimentos realizados en L.
migratoria y E. plorans fueron del 2-3%, por lo que consideramos que toda variante de
ITS2 que superase esta frecuencia en una muestra determinada era muy probablemente
un haplotipo genuino. Esto indicó que en L. migratoria sólo había un haplotipo para la
región ITS2, mientras que en E. plorans había 6 haplotipos (Hap1-Hap6). Los 6
haplotipos de E. plorans son reales, ya que Hap1-Hap5 han sido encontrados también
por Teruel y col. (enviado) usando secuenciación Sanger, y el Hap6 ha sido detectado
también en una población española por Ruiz-Ruano y col. (en preparación). La
194
Discusión general
coexistencia de seis haplotipos indica que existe una gran variabilidad intragenómica en
E. plorans que contrasta con la existencia de un solo tipo de secuencia codificadora
(para los 123 nt analizados en el ADNr 5.8S y 28S) en más del 97% de las lecturas
obtenidas de ADNg. Este resultado se ajusta a los modelos de evolución concertada
(Eickbush y Eickbush, 2007; Ganley y Kobayashi, 2007), aunque denota una baja
eficiencia de los mecanismos de homogenización de las regiones no codificadoras del
ADNr en esta especie.
Uno de los resultados más interesantes de este estudio fue encontrar que uno de
los haplotipos (Hap4) está ausente en los machos sin B y es más abundante conforme
aumenta el número de cromosomas B, por lo que podemos concluir que se trata de un
haplotipo específico del cromosoma B. Este haplotipo es, además, el único de los seis
que lleva la inserción de la adenina diferencial en base a la cual se diseñaron los primers
para amplificar la secuencia ITS2_B, en la que se ha centrado la presente tesis, con lo
que una vez más se corrobora que los datos de Sanger y secuenciación masiva son
comparables. Esto indica además, que nuestros análisis anteriores con los primers
qITS2_B estaban, en realidad, analizando el haplotipo Hap4. Este haplotipo es, de los 6
encontrados, el que tiene en el gDNA una región codificante adyacente menos
conservada, acorde con el hecho de que la naturaleza heterocromática del B le permite
acumular mutaciones, y que no todas las copias de ADNr tienen que ser funcionales
para transcribirse, ya que solo el 50% de ellas están activas (Reeder y col. 1999). Hap4
sólo apareció en el cDNA de 5 de los 11 machos portadores de B, y en mucha menor
proporción que en el gDNA, por lo que se expresa a niveles muy bajos y está muy
silenciado en las poblaciones, en concordancia con nuestros resultados anteriores que
habían demostrado que, tras analizar 7 poblaciones, sólo 18 machos de los 156
analizados mostraron actividad en la NOR del B. Los 5 machos con Hap4 tenían
además un nucleolo asociado a la NOR del B, lo que vuelve a corroborar que es el
ADNr del propio B el que está activo. Al analizar las regiones codificadoras,
observamos que las lecturas obtenidas en el cDNA son más conservadas que las del
gDNA, por lo que parece que hay preferencia en expresar las unidades más
conservadas. Este tipo de selección de ciertos ADNr para ser expresados es consistente
con un modelo propuesto por Zhou y col. (2013) en el que un genoma con
retrotransposones R2 en su ADNr selecciona para la transcripción aquellas copias con
menor densidad de R2. En el caso de E. plorans, el 100% de las lecturas de cDNA que
llevaban Hap4 (específico del B) en el ITS2 estaban asociadas a ambos lados con
regiones codificadoras conservadas. Esto indica que los transcritos de ARNr producidos
a partir de las copias de ADNr del B son funcionales. Y además sugiere que la
transcripción del B está sujeta a vigilancia genómica porque sólo se expresan en el B las
copias más conservadas en la región codificadora. En experimentos anteriores donde
cuantificábamos el número de copias del ADNr del B, habíamos detectado en
individuos 0B algunas secuencias que llevaban la inserción de la adenina diferencial del
B, pero no podemos decir si se trataba del Hap4 o no, ya que en dicho experimento se
amplificaba una región menor del ITS2. Aún así, de las 62322 secuencias obtenidas
aquí para el gDNA, 9205 corresponden al Hap4 y ninguna pertenece a los individuos
195
0B. Por tanto, la presencia de la inserción de adenina en el ITS2 de los individuos 0B en
forma de un haplotipo diferente al Hap4, y que además esté en los Bs, es un aspecto a
estudiar a más profundidad en un futuro.
La estructura secundaria del ITS2 juega un papel importante en definir los sitios
de rotura para su escisión durante la maduración del ADNr transcrito (Musters y col.
1990; van der Sande y col. 1992). Los 6 haplotipos ITS2 encontrados en nuestro análisis
tienen una estructura secundaria y una energía libre de Gibb muy conservadas, por lo
que todos tienen la misma posibilidad de ser expresados, incluido el Hap4. Esto sugiere
que la región del ITS2 del ADNr del B es funcional. El árbol de mínima expansión
corroboró por un lado, que la homogenización del ITS2 es muy pobre en este genoma, y
reveló por otro, que Hap1 no sólo es el haplotipo más frecuente, sino también
probablemente el ancestral. Este último dato concuerda con otros estudios en el que se
ha visto que este haplotipo es el más frecuente en machos sin B de otras regiones
mediterráneas (Ruiz-Ruano y col., en preparación).
Las diferencias de expresión de los diferentes haplotipos ITS2 de E. plorans
entre diferentes partes del cuerpo (Hap1-Hap3) e individuos (Hap1-Hap6) se repiten, en
general estando el Hap1 sobreexpresado y el Hap3 subexpresado. Aún así, este patrón
no es estricto, mostrando pequeñas diferencias entre partes del cuerpo. Remarcable es el
caso de dos partes del cuerpo importantes para el movimiento del animal (músculo alar
y pata saltadora) que muestran un patrón idéntico, y el del testículo, que es la única
parte corporal en el que se expresan casi por igual los tres haplotipos. En el experimento
poblacional observamos que Hap3, Hap4 y Hap6 están subexpresados. Por el contrario,
Hap5 es el haplotipo que muestra la mayor eficiencia en la expresión, y también es el
que tiene la mayor conservación de la región codificante adyacente.
Las diferencias de expresión existentes, que a la vez son propias de cada
haplotipo, sugieren una expresión no aleatoria de la copias de ADNr, la cual sería
posible si los haplotipos no estuvieran distribuidos al azar entre los cromosomas con
ADNr. Así, la búsqueda de los 6 haplotipos detectados en E. plorans en las secuencias
de ITS2 analizadas por Teruel y col. (enviado) (procedentes de diferentes cromosomas
microdiseccionados de la misma especie) ya apunta que hay cierta estructuración: Hap1
está en al menos los cromosomas 8, 9, X y B, Hap2 está en el cromosoma 11 y el Hap4
en el B. Esta ordenación y una pobre recombinación ectópica entre el ADNr de
cromosomas no homólogos contribuirían a la variabilidad intragenómica observada.
La menor homogenización de la región ITS2 en E. plorans en comparación con
L. migratoria podría ser debida a varias causas. El genoma de E. plorans es alrededor
del doble del de L. migratoria (Ruiz-Ruano y col. 2011), y es más difícil homogenizar
mayores cantidades de ADNr. De hecho, E. plorans tiene ADNr en siete parejas
autosomas además del cromosoma B (Cabrero y col. 1999, 2003a), fruto de su reciente
dispersión intragenómica desde los cromosomas 9 y 11 (López-León y col. 2008),
mientras que L. migratoria sólo lo lleva en tres (Teruel y col. 2010). Además, E.
plorans tiene 15000 copias de ADNr en los As y 3000 en el B 24 (Montiel y col., en
preparación). En L. migratoria no existen datos comparables, pero las señales de FISH
196
Discusión general
obtenidas para el ADNr son de menor tamaño que las de E.plorans. Sin embargo, el
hecho de que haya otras especies de saltamontes con genoma grande y una región ITS2
muy homogeneizada, tales como Stauroderus scalaris (Ruiz-Ruano y col. en
preparación) nos hizo buscar otras razones para el caso de E. plorans.
Una posibilidad es que antes de la expansión genómica del ADNr, éste estaba
homogenizado al menos en cada cromosoma homólogo donde estaba localizado (9 y
11). En este momento podía haber dos haplotipos, uno por cromosoma. Posteriormente,
y quizás coincidiendo con el origen del cromosoma B, se produjo una mezcla de
poblaciones que incrementó el número de haplotipos. Algunos datos apuntan a una (o
más) dispersiones recientes de esta especie por la región mediterránea. Por ejemplo,
como hemos visto anteriormente, B1 es la variante ancestral compartida por diferentes
poblaciones de toda la región mediterránea occidental. Además, el marcador SCAR,
específico de los Bs muestra una secuencia de 1510 pb muy conservada en poblaciones
tan distantes como España y Armenia, lo que sugiere el origen reciente de los Bs
(Muñoz-Pajares y col. 2011) y su dispersión rápida a casi todas las poblaciones de la
subespecie E. p. plorans. Esta mezcla, y la posible baja eficacia de la homogenización
no homóloga en esta especie explicaría por qué no están homogeneizadas las secuencias
de ITS2 en la población española analizada.
En conclusión, lo que comenzó siendo una única diferencia en toda la secuencia
del ADNr del B respecto a los demás cromosomas, es decir, una simple adenina
diferencial en el ITS2 del B, se ha convertido en el inicio de un apasionante camino que
nos ha revelado i) que los Bs realmente siguen su propio camino evolutivo al no
compartir el Hap4 con los cromosomas A, ii) que, aunque está muy silenciados, no
están del todo inactivos, y iii) que los pocos transcritos que producen son funcionales y
su cantidad difiere entre las diferentes partes del cuerpo de E. plorans.
Referencias
Abdelaziz M, Teruel M, Chobanov D, Camacho JP, Cabrero J (2007) Physical mapping
of rDNA and satDNA in A and B chromosomes of the grasshopper
Eyprepocnemis plorans from a Greek population. Cytogenet Genome Res
119:143-6
Bakkali M, Cabrero J, López-León MD, Perfectti F, Camacho JPM (1999) The B
chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North
Africa. I. B variants and frequency. Heredity 83:428-434
Basu J, Bousbaa H, Logarinho E et al (1999) Mutations in the essential splindle
checkpoint gene Bub1 cause chromosome missegregation and fail to block
apoptosis in Drosophila. J Cell Biol 146(1):13-28
Brodin J, Mild M, Hedskog C, Sherwood E, Leitner T, Andersson B, Albert J (2013)
PCR-Induced transitions are the major source of error in cleaned Ultra-Deep
Pyrosequencing
Data.
PLoS
ONE
8(7):
e70388
doi:10.1371/journal.pone.0070388
197
Cabrero J, Alché JD, Camacho JPM (1987) Effects of B chromosomes of the
grasshopper Eyprepocnemis plorans on nucleolar organiser regions activity.
Activation of a latent NOR on a B chromosome fused to an autosome. Genome
29:116-121
Cabrero J, López-León MD, Gómez R, Castro AJ, Martín-Alganza A, Camacho JPM
(1997) Geographical distribution of B chromosomes in the grasshopper
Eyprepocnemis plorans, along a river basin, is mainly shaped by non-selective
historical events. Chromosome Res 5:194-198
Cabrero J, López-León MD, Bakkali M, Camacho JPM (1999). Common origin of B
chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity
83:435-439
Cabrero J, Perfectti F, Gómez R, Camacho JPM, López-León MD (2003a) Population
variation in the A chromosome distribution of satellite DNA and ribosomal
DNA in the grasshopper Eyprepocnemis plorans. Chromosome Res 11: 375381
Cabrero J, Teruel M, Carmona FD, Jiménez R, Camacho JPM (2007) Histone H3 lysine
9 acetylation pattern suggests that X and B chromosomes are silenced during
entire male meiosis in a grasshopper. Cytogenet Genome Res 119:135–142
Camacho JPM, Carballo AR and Cabrero J (1980) The B chromosome system of the
grasshopper Eyprepocnemis plorans sub. Plorans (Charpentier). Chromosoma
80:163-166
Carchilan M, Delgado M, Ribeiro T, Costa-Nunes P, Caperta A et al (2007)
Transcriptionally active heterochromatin in rye B chromosomes. Plant Cell
19:1738-1749
Chen ZJ, Pikaard CS (1997) Transcriptional analysis of nucleolar dominance in
polyploidy plants: biased expression/silencing of progenitor rRNA genes is
developmentally regulated in Brassica. Proc Nat Acad Sci USA 94:3442–3447
Cho J, Kimura H, Minami T, Ohgane J, Hattori N, Tanaka S, Shiota K (2001) DNA
methylation regulates placental lactogen I gene expression. Endocrinology
142:3389–3396
De Lucia F, Ni JQ, Vaillant C, Sun FL (2005) HP1 modulates the transcription of cellcycle regulators in Drosophila melanogaster. Nucleic Acids Res 33(9):28522858
Eickbush TH (2002) R2 and related site-specific non-long terminal repeat
retrotransposons. In: Craig NL, Craigie R, Gellert M, Lambowitz AM (eds)
Mobile DNA II. ASM Press, Washington, DC, pp 813–835
Eickbush TH, Eickbush DG (2007) Finely orchestrated movements: evolution of the
ribosomal RNA genes. Genetics 175(2):477-485
Eickbush DG, Ye J, Zhang X, Burke WD, Eickbush TH (2008) Epigenetic regulation of
retrotransposons within the nucleolus of Drosophila. Mol Cell Biol 28:6452–
6461
Eissenberg JC and Elgin SC (2000) The HP1 protein family: getting a grip on
chromatin. Curr Opin Genet Dev 10:204-210
Fanti L, Giovinazzo G, Berloco M, Pimpinelli S (1998) The heterochromatin protein 1
prevents telomere fusions in Drosophila. Mol Cell 2(5):527-538
Fox DP (1970) A non-doubling DNA series in somatic tissues of the
locusts Schistocerca gregaria (Forskål) and Locusta migratoria (Linn.).
Chromosoma 29:446-61
198
Discusión general
Ganley ARD, Kobayashi T (2007) Highly efficient concerted evolution in the ribosomal
DNA repeats: total rDNA repeat variation revealed by whole-genome shotgun
sequence data. Genome Research 17:184-191
Gilles A, Meglécz E, Pech N, Ferreira S, Malausa T, Martin JF (2011) Accuracy and
quality assessment of 454 GS-FLX Titanium pyrosequencing. Bmc Genomics
12:245
Han F, Lamb JC, Yu W, Gao Z, Birchler JA (2007) Centromere function and
nondisjunction are independent components of the maize B chromosome
accumulation mechanism. Plant Cell 19:524–533
Hattori N, Nishino K, Ko Y, Hattori N, Ohgane J, Tanaka S, Shiota K (2004b)
Epigenetic control of mouse Oct-4 gene expression in embryonic stem cells and
trophoblast stem cells. J Biol Chem 279:17063–17069
Hattori N, Imao Y, Nishino K, Hattori N, Ohgane J, Yagi S, Tanaka S, Shiota K (2007)
Epigenetic regulation of Nanog gene in embryonic stem and trophoblast stem
cells. Genes Cells 12:387–396
Henriques-Gil N, Santos JL, Arana P (1984) Evolution of a complex polymorphism in
the grasshopper Eyprepocnemis plorans. Chromosoma 89:290-293
Henriques-Gil N, Jones GH, Cano MI, Arana P, Santos JL (1986) Female meiosis
during oocyte maturation in Eyprepocnemis plorans (Orthoptera: Acrididae). Can
J Genet Cytol 28:84-87
Henriques-Gil N, Arana P (1990) Origin and substitution of B chromosomes in the
grasshopper Eyprepocnemis plorans. Evolution 44:747-753
Herndon LA, Schmeissner PJ, Dudaronek JM et al (2002) Stochastic and genetic factors
influence tissue-specific decline in ageing C. elegans. Nature 419(6909):808-814
Horáková AH, Bártová E, Galiová G, Uhlírová R, Matula P, Kozubek S (2010)
SUV39h-independent association of HP1 beta with fibrillarin-positive nucleolar
regions. Chromosoma 119(3):227-241. doi:10.1007/s00412-009-0252-2
Ide S, Miyazaki T, Maki H, Kobayashi T (2010) Abundance of ribosomal RNA gene
copies maintains genome integrity. Science 327:693-696
Imamura T, Ohgane J, Ito S, Ogawa T, Hattori N, Tanaka S, Shiota K (2001) CpG
island of rat sphingosine kinase-1 gene: Tissue-dependent DNA methylation
status and multiple alternative first exons. Genomics 76:117–125
Larson K, S J Yan, Tsurumi A et al (2012) Heterochromatin formation promotes
longevity and repress ribosomal RNA synthesis. PLoS Genetics 8(1): e1002473.
doi:10.1371/journal.pgen.1002473
Lee DH, Li Y, Shin DH et al (2013) DNA microarray profiling of genes differentially
regulated by three heterochromatin protein 1 (HP1) homologs in Drosophila.
Biochem Biophys Res Commun 434(4):820-828
Liu LP, Ni JQ, Shi YD, Oakeley EJ, Sun FL (2005) Sex-specific role of Drosophila
melanogaster HP1 in regulating chromatin structure and gene transcription.
Nature Genetics 37:1361-1366
López-León MD, Cabrero J, Camacho JPM (1991) A nucleolus organizer region in a B
chromosome inactivated by DNA methylation. Chromosoma 100:134-138
López–León MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL (1993)
Generating high variability of B chromosomes in the grasshopper Eyprepocnemis
plorans. Heredity 71:352-362
López-León MD, Neves N, Schwarzacher T, Heslop-Harrison TS, Hewitt GM,
Camacho JPM (1994). Possible origin of a B chromosome deduced from its
DNA composition using double FISH technique. Chromosome Res 2:87-92
199
López-León MD, Cabrero J, Camacho JPM (1995) Changes in DNA methylation during
development in the B chromosome NOR of the grasshopper Eyprepocnemis
plorans. Heredity 74:296-302
López-León MD, Cabrero J, Dzyubenko VV., Bugrov AG, Karamysheva TV, Rubtsov
NB, Camacho JPM (2008) Differences in ribosomal DNA distribution on A and
B chromosomes between eastern and western populations of the grasshopper
Eyprepocnemis plorans plorans. Cytogenet genome Res 121:260-265
Muñoz E, Perfectti F, Martín-Alganza A, and Camacho JPM (1998) Parallel effect of a
B chromosome and a mite decreasing female fitness in the grasshopper
Eyprepocnemis plorans. Proc R Soc Lond Ser B. 265:1903-1909
Muñoz-Pajares AJ, Martínez-Rodríguez L, Teruel M, Cabrero J, Camacho JPM,
Perfectti F (2011) A single, recent origin of the accessory B chromosome of the
grasshopper Eyprepocnemis plorans. Genetics 187:853-863
Musters W, Boon K, Van der Sande CA, Van Heerikhuizen H, Planta RJ (1990)
Functional analysis of transcribed spacers of yeast ribosomal DNA. The EMBO
journal 9:3989
Niklas N, Pröll J, Danzer M, Stabentheiner S, Hofer K, Gabriel C (2013) Routine
performance and errors of 454 HLA exon sequencing in diagnostics. BMC
Bioinformatics 14:176
Nishino K, Hattori N, Tanaka S, Shiota K (2004) DNA methylation-mediated control of
Sry gene expression in mouse gonadal development. J Bio Chem 279: 22306–
22313
Ohgane J, Aikawa J, Ogura A, Hattori N, Ogawa T, Shiota K (1998) Analysis of CpG
islands of trophoblast giant cells by restriction landmark genomic scanning. Dev
Genet 22:132–140
Sollner-Webb B, Tower J (1986) Transcription of cloned eukaryotic ribosomal RNA
genes. Annu Rev Genet 55:801-830
Penton EH, Sullender BW, Crease TJ (2002) Pokey, a new DNA transposon in Daphnia
(Cladocera: Crustacea). J Mol Evol 55(6):664–673
Piacentini L, Fanti L, Negri R et al (2009) Heterochromatic protein 1 (HP1a) positively
regulates euchromatic gene expression through RNA transcript association and
interaction with hnRNPs in Drosophila. PLoS Genetics 5(10):e1000670.
doi:10.1371/journal.pgen.1000670
Pikaard CS (2000a) Nucleolar dominance: uniparental gene silencing on a
multimegabase scale in genetic hybrids. Plant Mol Biol 43:163-177
Pikaard CS (2000b) The epigenetics of nucleolar dominance. Trends in Genetics
16:495-500
Reeder RH (1999) Regulation of RNA polymerase I transcription in yeast and
vertebrates. Prog Nucleic Acid Res Mol Biol 62:193-327
Rogers SO and Bendich AJ (1987) Ribosomal RNA genes in plants: variability in copy
number and in the intergenic spacer. Plant Molcelular Biology 9:509-520
Ruiz-Ruano FJ, Ruiz-Estévez M, Rodríguez-Pérez J, López-Pino JL, Cabrero J,
Camacho JPM, (2011) DNA amount of X and B chromosomes in the
grasshoppers Eyprepocnemis plorans and Locusta migratoria. Cytogenet genome
Res 134:120-126
Ruthenburg AJ, Li H, Patel DJ, Allis CD (2007) Multivalent engagement of chromatin
modifications by linked binding modules. Nature Reviews Mol Cell Bio 8:983–
994
200
Discusión general
Savitsky M, Kravchuk O, Melnikova L, Georgiev P (2002) Heterochromatin Protein 1
is involved in control telomere elongation in Drosophila melanogaster. Mol and
Cel Biol 22:3204-3218
Sdek P, Oyama K, Angelis E, Chan SS, Schenke-Layland K, MacLellan WR (2013)
Epigenetic regulation of myogenic gene expression by heterocromatic protein 1
alpha. PLoS ONE 8(3): e58319. doi:10.1371/journal.pone.0058319
Serrano A, Rodríguez-Corsino M, Losada A (2009) Heterochromatin Protein 1 (HP1)
do not drive pericentromeric cohesin enrichment in human cells. PLoS One 4(4):
e5118. doi:10.1371/journal.pone.0005118
Sharma GG, Hwang KK, Pandita et al (2003) Human heterochromatin protein 1
isoforms HP1Hs alpha and HP1Hs beta interfere with hTERT-telomere
interactions and correlate with changes in cell growth and response to ionizing
radiation. Mol and Cel Biol 23(22):8363-8376
Shen C, Maniatis T (1980) Tissue-specific DNA methylation in a cluster of rabbit betalike globin genes. Proc Natl Aca. Sci 77: 6634–6638
Shiota K, Kogo Y, Ohgane J, Imamura T, Urano A, Nishino K, Tanaka S, Hattori N
(2002) Epigenetic marks by DNA methylation specific to stem, germ and somatic
cells in mice. Genes Cells 7:961–969
Strichman-Almashanu LZ, Lee RS, Onyango PO, Perlman E, Flam F, Frieman MB,
Feinberg AP (2002) A genome-wide screen for normally methylated human CpG
islands that can identify novel imprinted genes. Genome Res. 12:543–554
Subrahmanyam NC, Bryngelsson T, Hagberg P, Hagberg A (1994) Differential
amplification of rDNA repeats in barley translocation and duplication lines: role
of a specific segment. Hereditas 121:157–170
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2007) Nucleolus size variation during
meiosis and NOR activity of a B chromosome in the grasshopper Eyprepocnemis
plorans. Chromosome Res 15:755-765
Teruel M (2009) Origen, expresión y efectos fenotípicos de un parásito genómico. PhD.
Universidad de Granada
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2009) Quantitative analysis of NOR
expression in a B chromosome of the grasshopper Eyprepocnemis plorans.
Chromosoma 118:291-301
Teruel M, Cabrero J, Perfectti F, Camacho JPM (2010) B chromosome ancestry
revealed by histone genes in the migratory locust. Chromosoma 119: 217–225
Van der Sande CA, Kwa M, van Nues RW, van Heerikhuizen H, Raué HA, Planta RJ
(1992) Functional analysis of internal transcribed spacer 2 of Saccharomyces
cerevisiae ribosomal DNA. Journal of molecular biology 223:899-910
Zhou J, Eickbush TH (2009) The pattern of R2 retrotransposon activity in natural
population of Drosophila simulans reflects the dynamic nature of rDNA locus.
PLoS Genet 5:e1000386
Zhou J, Eickbush MT, Eickbush TH (2013) A Population Genetic Model for the
Maintenance of R2 Retrotransposons in rRNA Gene Loci. PLoS Genet 9(1):
e1003179. doi:10.1371/journal.pgen.1003179
Zurita S, Cabrero J, López-León MD, Camacho JPM (1998) Polymorphism
regeneration for a neutralized selfish B chromosome. Evolution 52:274-277
201
202
Capítulo 10. Conclusiones
203
204
Conclusiones
1. Los cromosomas B de Eyprepocnemis plorans son funcionales, al menos en el ADNr
que contienen.
2. El cromosoma B1 es el antecesor de todos los cromosomas B de esta especie
encontrados en la región mediterránea occidental.
3. Los cromosomas B de E. plorans estaban presentes en todas las partes corporales
analizadas, lo que sugiere que son mitóticamente estables. No hemos podido, sin
embargo, averiguar si todas estas partes tienen el mismo número de Bs, ya que la
herramienta molecular que intentamos diseñar estaba basada en el número de copias de
ADNr en los Bs y éste resultó ser muy variable entre Bs de la misma población.
4. Cuando el ADNr del cromosoma B está activo en un individuo, lo está en todas las
partes corporales analizadas, pero su grado de expresión en testículo, glándula accesoria
y músculo alar es el triple que en cabeza, pata y ciego gástrico.
5. La proteína HP1 es necesaria para mantener el patrón de condensación cromosómica
normal de todos los tipos de cromatina en E. plorans, y su función es vital en esta
especie. La disminución de los niveles de expresión de HP1, forzada por el ARNi,
estaba asociada a la disminución de la expresión del gen Bub1, el descenso del número
de células en división, la pérdida de masa muscular y limitación del movimiento, la
disminución de la cantidad de hemolinfa y en última instancia, la muerte.
6. El uso de la región codificadora 5.8-28S como control interno de la tasa de error de
los experimentos de “454 amplicon sequencing” es, en el caso del ITS2, una
herramienta muy útil para eliminar falsos positivos.
7. El ADNr de E. plorans está muy homogenizado en las regiones codificadoras 5.8S y
28S, pero no tanto en la región ITS2, donde hemos detectado 6 haplotipos en una misma
población. Todos los haplotipos mostraban características conservadas en su estructura
secundaria, y unos parámetros de energía libre de Gibbs compatibles con su capacidad
de expresión. De hecho, todos fueron encontrados en el ADNc.
8. El haplotipo Hap4 resultó ser exclusivo de los cromosomas B, ya que el número de
lecturas encontradas en ADNg aumentaba con el número de Bs, y no se encontró en los
individuos sin B.
9. Los 6 haplotipos mostraron diferencias en el grado de expresión, siendo Hap5 el más
eficiente en su expresión y el Hap4 (el del B) el menos eficiente, ya que se expresaba
muy poco incluso en individuos que mostraban que sus Bs eran capaces de organizar un
nucleolo. Igualmente, Hap3 y Hap6 eran haplotipos poco eficientes en su expresión,
mientras que Hap1 y Hap2 se encontraban entre los más eficientes.
10. El Hap4 es el único cuyas regiones codificadoras estaban conservadas en el 100%
de las lecturas en ADNc, a pesar de que, en ADNg, es el haplotipo menos conservado.
Esto sugiere que la expresión del ADNr del B está sujeta a una fuerte vigilancia por
205
parte del genoma, es decir, normalmente está muy reprimido, pero cuando se expresa
sólo lo hacen sus unidades de ADNr que están más conservadas en la región
codificadora.
11. En general, las lecturas de ADNc mostraron menor diversidad nucleotídica para la
región ITS2, y estaban más conservadas en las regiones codificadoras 5.8S y 28S, que
las del ADNg, por lo que podemos concluir que las unidades de ADNr no se expresan al
azar.
12. La total conservación de las regiones codificadoras en las lecturas de ADNc
observadas para el Hap4 sugiere que el ARNr transcrito a partir del cromosoma B es
totalmente funcional, como lo prueba además que en los 5 machos donde obtuvimos
lecturas para este haplotipo en ADNc los Bs fueron observados formando nucleolo, que
es el fenotipo de estos genes.
206
Capítulo 11. Perspectivas
207
208
Perspectivas
Los estudios realizados en la presente Tesis Doctoral han permitido profundizar en el
conocimiento de la estructura y la expresión del ADNr del cromosoma B de
Eyprepocnemis plorans. Los resultados expuestos nos han dado mucha información
sobre ello, pero a la vez han abierto otros frentes para futuras investigaciones.
Hemos visto que tres de las cuatro variantes de cromosomas B presentes en las
poblaciones españolas tienen el ADNr activo y que, además, se considera que las
variantes de B del oeste mediterráneo son de un tipo diferente a las de la zona este. Una
manera de continuar esclareciendo la conexión que hay entre ambos tipos de variantes y
el momento de origen del B sería estudiar la expresión de los Bs de poblaciones no
españolas.
La activación de la NOR del B y la transcripción del ARNr procedente de dicho
cromosoma parece estar asociado a cambios epigenéticos relacionados con la metilación
del ADN y acetilación de histonas. Sería interesante profundizar en este estudio de
marcas epigenéticas del B, incluso detectando el grado de variación si las hubiera, para
así estar más cerca de elucidar a qué se debe que unos B estén activos y otros no, o
incluso por qué una misma variable esté activa o no en diferentes poblaciones.
La detección de la expresión diferencial del ADNr del B en tejidos relacionados
con la reproducción y la supervivencia abre el camino de estudio de la contribución
molecular de esos transcritos a la eficacia biológica. Sería interesante estudiar la
transcendencia que estos transcritos tienen, ya que son funcionales y pueden estar
produciendo algún efecto (beneficioso o no), sobre E. plorans.
Tras disminuir los niveles de expresión de HP1, vimos que no había ningún
efecto sobre los genes ribosómicos de E. plorans o, al menos, no fueron detectables.
Podría ser que realmente esta proteína no regule la expresión del ARNr en esta especie,
ya que hemos visto que los efectos pueden ser dependientes de especie. Por tanto, un
análisis a realizar sería buscar proteínas que estén afectando a la expresión del ADNr en
E. plorans, para así tratar de encontrar qué proteínas están produciendo el
silenciamiento/la activación del ADNr del cromosoma B.
Por otro lado, sería interesante analizar si el hecho de que los cromosomas B
tengan alta variabilidad para el número de copias de ADNr es heredable, es decir, si
padres con Bs portadores de muchas copias de ADNr tienen descendientes con Bs
portadores de un número similar de copias, o bien se producen cambios en el número de
copias de ADNr del B en el transcurso de una sola generación.
La elevada variabilidad encontrada para las secuencias ITS2 entre diferentes
partes corporales e individuos de E.plorans sugiere estudiarla en mayor profundidad al
nivel intragenómico. Hemos discutido la posible localización no aleatoria de los
diferentes haplotipos en diferentes cromosomas, pero habría que corroborarlo haciendo
el mismo experimento sobre el ADN obtenido de los cromosomas microdiseccionados,
por separado. Esto nos permitiría también intentar averiguar el origen cromosómico del
209
B, siguiendo el rastro del haplotipo específico del B. Además, sería interesante realizar
un experimento como el realizado en la población de Torrox, mediante secuenciación
454, pero ampliando el número de poblaciones para averiguar la distribución de los
diferentes haplotipos a lo largo de la distribución geográfica de esta especie. Esto
proporcionaría información muy valiosa sobre la estructura genómica interpoblacional
del ITS2 y, en última instancia, podría conducir a elucidar la población donde
probablemente se originó el B.
Finalmente, la metodología utilizada en el experimento de pirosecuenciación
454, utilizando ADNg y ADNc de los mismos individuos, puede abrir una vía para
nuevos análisis, en esta y otras especies, que pueden ser muy valiosos para estudios de
la expresión del ADNr al nivel genómico. Esto será muy provechoso, con toda
seguridad, cuando los métodos de secuenciación masiva proporciones mayores tamaños
de lectura con menores errores de secuenciación.
210