03-024 (Transformación genética...)

TRANSFORMACIÓN GENÉTICA DEL NARANJO AGRIO
USANDO Agrobacterium rhizogenes
GENETIC TRANSFORMATION OF SOUR ORANGE USING Agrobacterium rhizogenes
Norma A. Chávez-Vela, Lucía I. Chávez-Ortiz,
y Eugenio Pérez-Molphe Balch
Centro de Ciencias Básicas. Universidad Autónoma de Aguascalientes. Av. Universidad 940.
20100 Aguascalientes, Aguascalientes, México. Tel.: (449)910-84-20, Fax. (449)910-84-01
(eperezmb@correo.uaa.mx)
RESUMEN
ABSTRACT
Se regeneraron plantas transgénicas de naranjo agrio (Citrus
aurantium L.) a partir de raíces transformadas con
Agrobacterium rhizogenes. Para obtener las raíces transformadas se cocultivaron, por 96 h, segmentos internodales de tallo
de plántulas germinadas in vitro con A. rhizogenes cepa A4 con
el plásmido ESC4 que contiene los genes nptII y gus. La mayor
eficiencia se obtuvo al usar una suspensión de 1×
×108 células
−1
mL y 96 h de cocultivo. En estas condiciones, 91% de los
explantes produjeron raíces transformadas, con un promedio
de 3.6 raíces por explante. Para la regeneración de brotes se
cultivaron segmentos de raíz transformada en medio con 5.0 mg
L−1 de benciladenina (BA) y 1.0 mg L−1 de ácido naftalenacético
(ANA). En este medio, 18% de los segmentos de raíz transformada produjeron brotes adventicios con un promedio de 1.25
brotes por explante. La actividad de gus fue evidente en las
raíces transformadas y los brotes y plantas regeneradas. La
presencia de los genes foráneos fue confirmada por análisis
PCR y Southern blot. Este sistema se utilizó posteriormente
para generar raíces y brotes de naranjo agrio transformados
con el gen que codifica para la proteína de la cápside del Virus
de la Tristeza de los Cítricos.
Transgenic Sour orange (Citrus aurantium L.) plants were
regenerated from Agrobacterium rhizogenes-transformed roots.
To obtain the transformed roots, internodal stem segments from
in vitro germinated seedlings were cocultured for 96 h with
Agrobacterium rhizogenes strain A4 with the ESC4 plasmid that
contains the nptII and gus genes. The highest efficiency was
obtained using a suspension of 1×
×108 cells mL−1 and 96 h of
coculture. Under these conditions, 91% of the explants produced
transformed roots with an average of 3.6 roots per explant.
For shoot regeneration, segments of transformed roots were
cultured on regeneration medium with 5.0 mg L−1 benzyladenine
(BA) and 1.0 mg L−1 napthaleneacetic acid (NAA). In this
medium, 18% of the transformed root segments produced
adventitious shoots, with an average of 1.25 shoots per explant.
Gus activity was evident in the transformed roots, shoots and
regenerated plants. The presence of the foreign genes was
confirmed by PCR analysis and Southern blot. Afterwards, this
system was used to generate sour orange roots and shoots
transformed with the gene that codes for the capsid protein of
the Citrus Tristeza Closterovirus.
Keywords: Citrus aurantium, citrus Tristeza Closterovirus (CTV),
Palabras clave: Citrus aurantium, raíces transformadas, virus de
la Tristeza de los Cítricos (VTC).
transformed roots.
INTRODUCTION
INTRODUCCIÓN
S
our orange (Citrus aurantium L.) is used for
extraction of essential oils and production of
marmalades and conserved foods. However, its
greatest importance lies in its use as rootstock for
production of other Citrus species. In México, practically
all commercial plantations of sweet orange, tangerine
and grapefruit, as well as 16% of Mexican lime, are
grafted on sour orange, which represents 85% to 90% of
Mexican citrus production. Such a widespread use of
sour orange is due to the fact that it supports crops of
excellent internal quality, with high content of soluble
solids and acidity, apart from its greater tolerance to
drought and alkaline soils in comparison to other
E
l naranjo agrio (Citrus aurantium L.) se utiliza
para la extracción de aceites esenciales y para la
elaboración de mermeladas y conservas. Sin
embargo, su mayor importancia radica en su uso como
portainjertos para la producción de otros cítricos. En
México, prácticamente todas las plantaciones comerciales de naranja dulce, mandarina y toronja, así como 16%
de limón mexicano, están injertados sobre naranjo agrio,
lo que representa 85 a 90% de la citricultura nacional.
Esto se debe a que promueve cosechas de excelente
Recibido: Abril, 2003. Aprobado: Octubre, 2003.
Publicado como ARTÍCULO en Agrociencia 37: 629-639. 2003.
629
630
AGROCIENCIA VOLUMEN 37, NÚMERO 6, NOVIEMBRE-DICIEMBRE 2003
calidad interna, con altos contenidos de sólidos solubles y acidez, y es más tolerante a la sequía y a suelos
alcalinos que otros portainjertos. Es resistente a la
gomosis, exocortis, xiloporosis y psorosis de los cítricos, aunque altamente susceptible al Virus de la Tristeza
de los Cítricos (VTC) (Orozco-Santos, 1996; DurónNoriega et al., 1999), lo que ha impulsado la substitución del naranjo agrio por otros patrones que no tienen
todas sus ventajas pero son más tolerantes al VTC (Rocha-Peña et al., 1995).
La única opción para seguir usando el naranjo agrio
como portainjertos es la generación de plantas resistentes a VTC, y la herramienta más eficiente para lograrlo es
la transformación genéticas. En la mayoría de transformaciones genéticas en cítricos se ha usado sistemas basados en Agrobacterium tumefaciens (Peña y Navarro,
1999). Con la transformación genética del naranjo agrio
mediante el uso de A. tumefaciens se obtuvieron dos
plantas transgénicas con los genes gus, nptII y el de la
cápside del VTC (Gutiérrez et al., 1997). El estudio de
factores que afectan la transformación de esta especie
por A. tumefaciens permitió desarrollar un sistema más
eficiente para generar algunas plantas transformadas con
el gen de la cápside del VTC (Ghorbel et al., 2000). Los
sistemas para la transformación genética de cítricos mediada por A. tumefaciens tienen algunas desventajas: La
baja eficiencia y alto porcentaje de quimeras; la baja
tasa de enraizamiento de los brotes transgénicos, lo que
obliga en muchos casos a microinjertarlos sobre patrones no transformados con el fin de recuperar plantas completas (Peña et al. 1995, 1999; Cervera et al. 1998a y b).
Por tanto, este sistema de transformación es poco aplicable a especies utilizadas como patrones y con un sistema
radical propio, como el naranjo agrio.
Un método que podría evitar estas desventajas sería
usar Agrobacterium rhizogenes como vector para la transformación, y consiste en la generación de raíces transformadas con los genes silvestres del plásmido Ri, más
los genes de interés en cada caso. Luego las raíces transformadas serían usadas como explantes para la regeneración de brotes transgénicos por la vía de la organogénesis.
La obtención de plantas transgénicas por este método se
ha reportado sólo para siete especies de frutales (Christey,
2001). En limón mexicano (Citrus aurantifolia Christm.),
la transformación con A. rhizogenes ha sido más eficiente que la basada en A. tumefaciens. Además, no se producen quimeras y los brotes transgénicos generados forman raíces con facilidad, probablemente debido a la inserción en el genoma de la planta de los genes rol de A.
rhizogenes (Pérez-Molphe-Balch y Ochoa-Alejo, 1998).
A pesar de estas ventajas, la transformación genética del
naranjo agrio usando A. rhizogenes no se ha reportado.
En este trabajo se describe el desarrollo de un sistema de
transformación para el naranjo agrio basado en el uso de
rootstocks. It is resistant to citrus gummosis, exocortis,
xyloporosis and psorosis, but highly susceptible to
Citrus Tristeza Closterovirus (CTV) (Orozco-Santos,
1996; Durón-Noriega et al., 1999). The above mentioned
has supported a strong trend of substitution of sour orange
for other rootstocks, that lack some of its advantages,
but are more tolerant to CTV (Rocha-Peña et al., 1995).
The only alternative that would allow for continual
use of sour orange as a rootstock in presence of CTV is
the generation of CTV-resistant plants. The most efficient
tool to attain this goal is genetic transformation. In most
of genetic transformation of Citrus species
Agrobacterium tumefaciens-based transformation
systems have been used (Peña and Navarro, 1999).
Gutiérrez et al. (1997) reported genetic transformation
of sour orange using A. tumefaciens, and obtained two
transgenic plants with gus, nptII and CTV capsid genes.
Ghorbel et al. (2000) studied several factors that affect
transformation of this species by A. tumefaciens, and
developed a more efficient system to generate some
plants transformed with the CTV capsid gene. A.
tumefaciens-mediated genetic transformation systems for
Citrus species have exhibited certain disadvantages: low
efficiency and high proportion of chimeras; low rooting
ratio of transgenic shoots, which in many cases has forced
researchers to perform micro-grafts on untransformed
rootstocks in order to retrieve whole plants (Peña et al.
1995, 1999, Cervera et al. 1998a y b). As a result, this
transformation system has low application to species used
as rootstocks and with a root system of their own, such as
sour orange.
A method that could eliminate these disadvantages
would be the use of Agrobacterium rhizogenes as a
transformation vector. This system consists of
transformed root generation with the wild-type plasmid
Ri genes, plus the genes of interest in each case. Then,
transformed roots would be used as explants for
regeneration of transgenic shoots via the organogenesis
path. Obtainment of transgenic plants by this method
has been reported for only seven species of fruit crops
(Christey, 2001). Transformation with A. rhizogenes in
Mexican lemon (Citrus aurantifolia Christm.) has proved
to be more efficient than A. tumefaciens-based
transformation. Furthermore, chimeras are not produced
and transgenic shoots grow roots with ease, probably
owed to the insertion of A. rhizogenes rol genes in the
plant genome (Pérez-Molphe-Balch y Ochoa-Alejo,
1998). Despite these advantages, genetic transformation
of sour orange using A. rhizogenes has not been reported.
The development of an A. rhizogenes-based
transformation system for sour orange is described in
this work, as well as its use for insertion of the gene that
codes for the CTV capsid protein into the sour orange
genome.
CHÁVEZ-VELA et al.: TRANSFORMACIÓN GENÉTICA DEL NARANJO AGRIO USANDO Agrobacterium rhizogenes
A. rhizogenes, así como su utilización para la introducción en su genoma de un gen que codifica para la proteína de la cápside del VTC.
MATERIALES Y MÉTODOS
631
MATERIALS AND METHODS
Plant material
Seventy-five-day-old sour orange seedlings were used as
source of explants for generation of transformed roots. The
Material vegetal
seedlings were obtained from seeds germinated in aseptic
conditions. Seeds were collected from selected ripe fruit produced
Como fuente de explantes para la generación de raíces transformadas se utilizaron plántulas de naranjo agrio (75 d edad),
obtenidas a partir de semillas germinadas en condiciones asépticas.
Las semillas se recolectaron de frutos maduros seleccionados procedentes del banco de germoplasma del Campo Experimental
Tecomán (Colima) del Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Las semillas se desinfectaron lavándolas tres veces por 10 min con detergente líquido
(Dermoclean) a 1% y enjuagándolas con agua corriente; luego se
lavaron con etanol a 70% durante 45 s y se trataron por 25 min
con una solución de blanqueador comercial (Cloralex) a 15%.
Finalmente se enjuagaron cuatro veces con agua destilada estéril
bajo condiciones de asepsia y se inocularon en el medio de cultivo. El medio utilizado fue MS 50% (Murashige y Skoog, 1962),
pH 5.7 y con 8 g L−1 de agar (Sigma). Los cultivos se mantuvieron
en la oscuridad a 25±2 oC por dos meses aproximadamente, y luego
se incubaron dos semanas bajo luz continua (54 mmol m−2 s−1).
in the Germoplasm Bank of the Tecomán Experimental Field of
the INIFAP (Instituto Nacional de Investigaciones Forestales,
Agrícolas y Pecuarias). The seeds were disinfected by washing
them three times during 10 min with 1% Dermocleen, and rinsed
with tap water; then they were washed with 70% percent ethanol
during 45 s and treated 25 min with a 15% commercial bleach
(Cloralex) solution. Finally, seeds were rinsed four times with
sterile distilled water in aseptic conditions and inoculated in culture
medium. The medium utilized was 50% MS (Murashige & Skoog,
1962), pH 5.7 with 8 g L−1 agar (Sigma). Cultures were kept in
the dark at 25±2
o
C during two months approximately, then
incubated two weeks under continuous light (54 mmol m−2 s−1).
Induction of transformed roots
A. rhizogenes A4 agropine-type strain was used to develop
the transformation system. A4 contains wild-type plasmid pRi A4
which confers hairy-root genotype, and binary vector pESC4.
Inducción de raíces transformadas
Para el desarrollo del sistema de transformación se utilizó la
Cepa A4 de A. rhizogenes, del tipo agropina, y contiene el plásmido
silvestre pRi A4 que confiere el genotipo de raíces pilosas, y el
plásmido pESC4 como vector binario. Este último lleva el gen
marcador de selección nptII bajo el control del promotor y
terminador nos, y el gen reportero de gus bajo el control del
promotor cab y el terminador ocs (Jofre-Garfias et al., 1997).
Una vez conocidas las condiciones óptimas para la transformación, se utilizó también el plásmido binario B249CP-pGA482GG,
el cual, además de los genes nptII y gus, contiene el gen que
codifica para la cápside de una variante severa del VTC originaria
de Venezuela (B249). Este gen se encuentra bajo el control de un
promotor constitutivo 35S. Para el cocultivo, la bacteria se inoculó en medio YMB líquido (Hooykaas et al., 1977) con 50 mg L−1
de rifampicina y 50 mg L−1 de kanamicina para el pESC4, o bien
50 mg L−1 de rifampicina y 12 mg L−1 de tetraciclina para el
B249CP-pGA482GG, y se incubó 72 h a 28 oC con agitación
orbital a 120 rpm. La densidad de la bacteria se determinó a partir
de la medición de absorbancia a 620 nm e interpolando en una
curva patrón. El cultivo bacteriano se diluyó en medio MS líquido. El cocultivo se realizó colocando segmentos internodales de
20 mm, con cortes transversales, dentro de la suspensión
bacteriana, por 45 min. Luego se eliminó el exceso de bacteria
con una gasa estéril y los explantes se transfirieron a medio MS
sólido sin antibióticos ni reguladores del crecimiento. Los cultivos se mantuvieron en la obscuridad a 28 oC por 48 a 96 h;
The latter carries the selection marker nptII gene under control of
nos promoter and terminator, and reporter gene gus under control
of cab promoter and ocs terminator (Jofre-Garfias et al., 1997).
Once optimal conditions for transformation were known, the binary
plasmid B249CP-pGA482GG was used as well, which in addition
to nptII and gus genes contains the gene that codes for the capsid
protein of a Venezuelan severe variant of CTV (B249). This gene
is under control of a 35S constitutive promoter. For co-culture,
bacteria were inoculated in liquid YMB medium (Hooykaas et al.,
1977) with 50 mg L−1 rifampicin and 50 mg L−1 kanamycin for
pESC4, or 50 mg L−1 rifampicin and 12 mg L−1 tetracyclin for
B249CP-pGA482GG, and were incubated 72 h at 28 oC on orbital
stirrer at 120 rpm. Bacterial density was determined from
absorbance measurement at 620 nm and interpolation on a
reference curve. Bacterial culture was diluted in liquid MS
medium. Co-culture was carried out by placing 20 mm internodal
segments, with transverse cuts, in the bacterial suspension for 45 min.
Excess bacteria were eliminated with sterile gauze and explants
were transferred to solid MS medium without antibiotics or growth
regulators. Cultures were kept in the dark at 28 oC for 48-96 h,
then the explants were transferred to selection medium. The
variables tested to establish the best conditions for co-culture were
bacterial suspension concentration (1×107, 1×108 and 1×109
cells mL−1) and time of co-culture (48, 72 and 96 h), performing
nine treatments in a completely random experimental design. Thirty
explants per treatment were used and three repetitions of the
experiment were conducted.
632
AGROCIENCIA VOLUMEN 37, NÚMERO 6, NOVIEMBRE-DICIEMBRE 2003
después los explantes se transfirieron a medio de selección. Las
variables para establecer las mejores condiciones para el cocultivo
fueron la concentración de la suspensión bacteriana (1×107,
1×108 y 1×109 células mL−1) y el tiempo de cocultivo (48, 72 y
96 h), con nueve tratamientos en un diseño completamente al
azar. Se utilizaron 30 explantes por tratamiento y se hicieron tres
repeticiones del experimento.
Posteriormente se probó el efecto de la adición de
acetosiringona en la suspensión bacteriana en concentraciones de
0, 50, 100 y 200 µM. El diseño fue completamente al azar con 30
explantes por tratamiento y tres repeticiones. Se utilizó la concentración bacteriana y tiempo de cocultivo consideradas mejores del
primer experimento (1×108 células mL−1 y 96 h). El medio de
selección fue el MS con 5% de sacarosa, 0.8% de agar, 500 mg L−1
de cefotaxima (Claforan, Russell), 500 mg L−1 de carbenicilina
(Carbecin, Sanfer), para eliminar a la bacteria, y 50 mg L−1 de
kanamicina (Sigma-Aldrich) como agente selectivo. Los cultivos
se incubaron a 28 oC en la oscuridad.
Los resultados se registraron a los 30 d y las respuestas evaluadas fueron el porcentaje de explantes que presentaron raíces y
el número de raíces por explante. Para conocer el efecto de los
tratamientos, se usó un análisis de varianza y una prueba de comparación de medias de Tukey. Las raíces obtenidas en los experimentos anteriores se subcultivaron cada 30 d a medio de selección
fresco y se incubaron en dos condiciones de iluminación: Luz
continua (54 mmol m−2 s−1) y obscuridad, para determinar cuál
de las dos condiciones favorecía el crecimiento de las raíces transformadas. Para lo anterior se registró el crecimiento de las raíces al
final del ciclo de cultivo y los datos se analizaron mediante una
prueba de Mann-Whitney.
Regeneración de brotes adventicios a partir
de las raíces transformadas
Se transfirieron segmentos de raíces transformadas a medios
de selección adicionados con tres combinaciones de reguladores
del crecimiento: a) 2.5 mg L−1 de BA con 0.5 mg L−1 de ANA; b)
5.0 mg L−1 de BA con 1.0 mg L−1 de ANA; c) 10 mg L−1 de BA
con 2.0 mg L−1 de ANA. Estos tratamientos se seleccionaron con
base en experimentos previos con tejido no transformado (no se
muestran esos datos). Como explantes se probaron segmentos de
raíz transformada de 15 mm de longitud inoculados en posición
horizontal con cortes transversales a lo largo del segmento, e
inoculados en posición vertical con la parte proximal sobresaliendo del medio. Los cultivos se incubaron en la oscuridad durante
8 d y luego bajo luz continua (54 mmol m−2 s−1) a 25 ± 2 oC.
Para este experimento se utilizó un diseño completamente al azar
con 30 explantes por tratamiento y dos repeticiones. Después de
30 d se registró el porcentaje de explantes que presentaron brotes
y el número de brotes por explante. Se usó un análisis de varianza
y una prueba de comparación de medias de Tukey. Los brotes
mayores de 15 mm se separaron del explante original y se transfirieron a medio sin reguladores para su enraizamiento. Las plantas
generadas se pasaron a suelo, conservándose por 40 d en una
cámara bioclimática y luego en invernadero.
Afterwards, the effect of adding acetosyringone to bacterial
suspension was tested, for 0, 50, 100 and 200 µM concentrations.
A completely random design was also used, with 30 explants per
treatment and three repetitions. In this case were used the bacterial
concentration and co-culture time that proved best in the first
experiment (1×108 cells mL−1 and 96 h). MS was used as selection
medium, with 5% sucrose, 0.8% agar, 500 mg L−1 cefotaxime
(Claforan, Russell), 500 mg L−1 carbenicilin (Carbecin, Sanfer),
both used to eliminate bacteria, and 50 mg L−1 kanamycin (SigmaAldrich) as selection agent. Cultures were incubated at 28 oC in
the dark.
Results were recorded after 30 d and the evaluated responses
were percentage of root-bearing explants and number of roots
per explant. To know the effect of the treatments, recorded data
were put through an analysis of variance (ANOVA) and a Tukey
Multiple Comparison test was used. The roots obtained in these
experiments were sub-cultured every 30 d in fresh selection
medium, and were incubated under two illumination conditions:
continuous light (54 mmol m−2 s−1) and darkness. The reason for
this was to determine which conditions favored growth of
transformed roots. In this manner, root growth was recorded at
the end of the culture cycle and data were analyzed in a MannWhitney test.
Regeneration of adventitious shoots
from transformed roots
Transformed root segments were transferred to selection
medium containing three combinations of growth regulators: a)
2.5 mg L−1 BA with 0.5 mg L−1 ANA; b) 5.0 mg L−1 BA with 1.0 mg
L−1 ANA; c) 10 mg L−1 BA with 2.0 mg L−1 ANA. These
treatments were selected based on previous experiments with
untransformed tissue (data not shown). Transformed root segments
(15 mm) were tested as explants, inoculated horizontally with
transverse cuts throughout the segments, and inoculated in upright position with the near end jutting out of the medium. Cultures
were incubated in the dark for 8 d, then kept under continuous
light (54 mmol m−2 s−1) at 25±2 oC. A completely random design
was used in this experiment, with 30 explants per treatment and
two repetitions. Percentage of shoot-bearing explants as well as
number of shoots per explant were recorded after 30 d. An analysis
of variance and a Tukey Multiple Comparison test were used.
Shoots longer than 15 mm were separated from the original explant
and transferred to medium without regulators in order to produce
roots. The obtained plants were transferred to soil, and kept for 40
days in a bioclimatic chamber and later in a greenhouse.
Characterization of transformed tissues
The histochemical assay to detect gus activity was carried out
by incubation of segments of presumptively transformed roots,
shoots and leaves, as well as negative controls, with the following
reagent mix: 0.1 M phosphate buffer, pH 7.0, 10 mM EDTA,
0.5 mM potassium ferrocyanide, 0.5 mM potassium ferricyanide,
CHÁVEZ-VELA et al.: TRANSFORMACIÓN GENÉTICA DEL NARANJO AGRIO USANDO Agrobacterium rhizogenes
Caracterización de los tejidos transformados.
El ensayo histoquímico para detectar la actividad de gus se
hizo incubando segmentos de raíz, brotes y segmentos de hojas
presuntamente transformados, así como testigos negativos, con
una mezcla de reacción (amortiguador de fosfatos 0.1 M, pH 7.0,
EDTA 10 mM, ferrocianuro de potasio 0.5 mM, ferricianuro de
potasio 0.5 mM, Tritón X-100 0.1% v/v y 5-bromo-4-cloro-3indolil-β-D-glucuronido 1 mM) a 37 oC hasta observar el precipitado color magenta en los tejidos transformados. Se eliminó la
clorofila de los tejidos lavándolos con etanol a 96%. Para el análisis PCR se extrajo el ADN de los tejidos vegetales (Edwards et al,
1991). Los genes a amplificar en el ADN vegetal transformado
con pESC4 fueron gus, nptII, rolB y virD1 (Hamill et al., 1991).
El gen virD1 de Agrobacterium no se transfiere al genoma de la
planta, por lo que se utiliza para descartar la presencia residual de
la bacteria en el tejido vegetal. Para el gen gus el iniciador 5’ fue
GGTGGGAAAGCGCGTTACAAG, y el 3’ GTTTACGCGTT
GCTTCCGCCA; éstos amplifican un segmento de 1200 pb. Para
el gen nptII el iniciador 5´ fue TATTCGGCTATGACTGGGCA, y
el 3´ GCCAACGCTATGTCCTGAT; éstos amplifican un segmento de 517 pb. Para rolB el iniciador 5’ fue ATGGATCCCAAA
TTGCTATTCCTTCCACGA, y el 3’ TTAGGCTTCTTTCTT
CAGGTTTACTGCAGC; éstos amplifican un segmento de 780 pb.
Para virD1 el iniciador 5’ fue ATGTCGCAAGGA CGTAAGCCCA,
y el 3’, GGAGTCTTTCAGCATGGAGCAA; éstos amplifican un
segmento de 450 pb. En las raíces y brotes transformados con el
plásmido B249CP-pGA482GG, se amplificó un segmento de 720 pb
del gen de la cápside del VTC. El iniciador 5’ fue
GGTTTGAACCATGGACGACGAAACAAA GAAATTG, y el 3’,
GGAACTCCACCA TGGCGATAGAAACC GGGAATCGG. Los
productos de la amplificación se analizaron en un gel de agarosa
a 1.25% teñido con bromuro de etidio. Para el Southern blot se
extrajo ADN de raíces presuntamente transformadas [Draper y
Scott, 1988]. El ADN fue digerido con HindIII y separado en un
gel de agarosa a 0.7%; se utilizaron 20 mg de ADN por carril.
Después de la electroforesis el gel se desnaturalizó con NaOH
0.5 M y NaCl 1.5 M, luego se neutralizó con Tris-HCl pH 8.0 1 M
y NaCl 1.5 M, se transfirió por capilaridad a una membrana de
nylon (Amersham Hybond-N+) y se fijó a 90 oC por 2 h. La sonda
fue un fragmento de 517 pb del gen npt II marcado con
digoxigenina (DIG). El marcaje de la sonda, la hibridización y la
detección se realizaron con el “Dig High Prime DNA Labeling
and Detection Starter Kit II” (Boehringer Mannheim, Germany).
RESULTADOS Y DISCUSIÓN
Inducción de raíces transformadas
Se obtuvieron raíces transformadas en todas las combinaciones de concentración bacteriana y tiempo de
cocultivo (Figura 1a). Sin embargo, la frecuencia de los
explantes que responden formando raíces, y el número
promedio de raíces por explante, fueron mayores al
cocultivar por 96 h con una suspensión de 1×108 células mL−1 (Cuadro 1).
633
1% v/v Triton X-100 and 1 mM 5-bromo-4-chloro-3-indolyl-βD-glucuronid. The reaction was conducted at 37°C until a magenta
precipitate showed up in transformed tissues. Chlorophyll was
eliminated from tissues by washing them with 96% ethanol. Plant
DNA for polymerase chain reaction (PCR) was extracted using
the method by Edwards et al. (1991). The genes to be amplified
in pESC4-transformed plant DNA were gus, nptII, rolB and virD1,
(Hamill et al., 1991). Agrobacterium virD1 gene is not transferred
to plant genome; therefore, it is used to discard residual presence
of bacteria in plant tissue. For the gus gene the 5’ primer was
GGTGGGAAAGCGCGTTACAAG, and 3’ GTTTACGCGTTGC
TTCCGCCA. These two amplify a 1200 bp segment. For the nptII
gene the 5’ primer was TATTCGGCTATGACTGGGCA, and 3’
GCCAACGCTATGTCCT GAT, and they amplify a 517 bp segment.
For
the
rolB
gene
the
5’
primer
was
ATGGATCCCAAATTGCTATTCCTTCCACGA,
and
3’
TTAGGCTTCTTTCTTCAGGTTTACTGCAGC, and these two
amplify a 780 bp segment. For virD1 the 5’ primer was
ATGTCGCAAGGACGTAAGCCCA, and 3’, GGAGTCTTTCAGC
ATGGAGCAA. These two amplify a 450 bp segment. In shoots
and roots transformed with the B249CP-pGA482GG plasmid, a
720 bp segment of the CTV capsid gene was amplified. The 5’
primer was GGTTTGAACCATGGACGACGAAACAAAGAA
ATTG, and 3’, GGAACTCCACCATGGCGATAGAAACCGGGA
ATCGG. Amplification products were analyzed in a 1.25% agarose
gel stained with ethidium bromide. DNA for Southern blot was
extracted from putatively transformed roots (Draper and Scott,
1988). DNA was digested with HindIII and separated in a 0.7%
agarose gel; 20 mg of DNA were used per lane. After electrophoresis
the gel was denatured with 0.5 M NaOH and 1.5 M NaCl, then
neutralized with 1 M Tris-HCl pH 8.0 and 1.5 M NaCl, then
blotted to a nylon membrane (Amersham Hybond-N+) and fixed
at 90 oC for 2 h. The probe was a 517 bp fragment of the npt II
gene labeled with digoxigenin (DIG). Labeling, hybridization
and detection of the probe were carried out with the “Dig High
Prime DNA Labeling and Detection Starter Kit II” (Boehringer
Mannheim, Germany).
RESULTS AND DISCUSSION
Induction of transformed roots
Transformed roots were obtained in all combinations
of bacterial concentration and co-culture time tested
(Figure 1a). However, the frequency of root formation in
explants, as well as the mean number of roots per explant,
were higher for the 96 h co-culture with a 1×108 cells
mL−1 suspension (Table 1).
Root generation frequency is similar to the one
observed in Mexican lime, where 94% of the explants
co-cultured with the same A. rhizogenes strain generated
transformed roots (Pérez-Molphe-Balch and Ochoa-Alejo,
1998). Addition of acetosyringone caused a higher
frequency of root-bearing explants when 50 µM of this
634
AGROCIENCIA VOLUMEN 37, NÚMERO 6, NOVIEMBRE-DICIEMBRE 2003
a
d
f
c
b
e
g
Figura 1. a) Generación de raíces transformadas en segmentos de tallo de naranjo agrio. b) Ensayo histoquímico para la detección
de gus en segmentos de raíces transformadas de naranjo agrio. La de la izquierda es un testigo no transformado
(barra = 1 mm). c) Generación de brotes en el extremo de un segmento de raíz transformada de naranjo agrio cultivada
en un medio con 5 mg L−1 BA y 1.0 mg L−1 ANA (barra = 1 mm). d) Ensayo histoquímico para gus en el extremo de un
segmento de raíz transformada de naranjo agrio con un primordio de brote. Nótese la actividad de gus en el brote en
formación (barra = 1 mm). e) Planta transgénica de naranjo agrio regenerada a partir de raíces transformadas con el
plásmido ESC4. f) Generación de raíces transformadas en segmentos de tallo de naranjo agrio cocultivados con A.
rhizogenes A4/B249CP-pGA482GG. g) Generación de brotes en el extremo de un segmento de raíz de naranjo agrio
transformada con el plásmido B249CP-pGA482GG (barra = 1 mm).
Figura 1. a) Generation of transformed roots in sour orange stem segments. b) Histochemical assay for detection of GUS sour
orange transformed root segments. Left: untransformed control (bar = 1 mm). c) Generation of shoots on one end of a
sour orange transformed root segment cultured in medium with 5 mg L−1 BA and 1.0 mg L−1 ANA (bar = 1 mm). d)
Histochemical assay for detection of gus on one end of a sour orange transformed root segment with shoot primordium.
Notice gus activity on emerging shoot (bar = 1 mm). e) Sour orange transgenic plant regenerated from roots transformed
with ESC4 plasmid. f) Generation of transformed root from sour orange stem segments co-cultured with A. rhizogenes A4/
B249CP-pGA482GG. g) Generation of shoots on one end of a sour orange root transformed with plasmid B249CPpGA482GG (bar = 1 mm).
CHÁVEZ-VELA et al.: TRANSFORMACIÓN GENÉTICA DEL NARANJO AGRIO USANDO Agrobacterium rhizogenes
La frecuencia de generación de raíces es similar a la
observada en limón mexicano, donde 94% de los
explantes cocultivados con la misma cepa de A.
rhizogenes generaron raíces transformadas (PérezMolphe-Balch y Ochoa-Alejo, 1998). La adición de
acetosiringona causó una mayor frecuencia de explantes
con raíces al añadir 50 µM de este compuesto a la suspensión bacteriana, aunque 200 µM mostró un efecto
inhibitorio (Cuadro 2). Este mismo fenómeno se ha reportado en otras especies al ser transformadas con A.
rhizogenes. En Brassica oleracea var. italica, la frecuencia
de explantes con raíces transformadas se incrementa al
usar 50 µM de acetosiringona, pero al elevar la concentración a 100 µM este valor baja (Henzi et al., 2000). En
el número de raíces por explante no hubo diferencias
significativas entre las cuatro concentraciones de
acetosiringona (Cuadro 2).
Las raíces transformadas mantenidas en la obscuridad mostraron un mayor crecimiento (6.7±1.5 cm en 30 d),
respecto a las incubadas en luz continua, que sólo
incrementaron 0.7±0.15 cm en el mismo período, diferencia significativa según la prueba de Mann-Whitney.
Las raíces incubadas bajo luz continua mostraron un
menor crecimiento, pero se mantuvieron vigorosas y adquirieron un color verde debido a la síntesis de clorofilas.
Regeneración de brotes adventicios a
partir de las raíces transformadas
Los segmentos de raíces transformadas inoculados
en posición vertical formaron brotes adventicios en el
extremo superior 15 a 30 d después de su transferencia a
dos de los tres medios de regeneración probados (Cuadro 3) (Figura 1c). La mayor frecuencia de explantes que
generaron brotes se observó en el medio con 5.0 mg L−1
de BA y 1.0 mg L−1 de ANA. El número promedio de
brotes por explante no mostró diferencia significativa
entre los dos tratamientos que produjeron brotes. En el
tratamiento con 10.0 mg L−1 de BA y 2.0 mg L−1 de ANA
no se observó respuesta alguna, debido probablemente
a que estas concentraciones elevadas de reguladores del
crecimiento resultaron tóxicas para el tejido. La eficiencia de la combinación de BA con ANA para la generación de brotes transformados en naranjo agrio ha sido
reportada por Ghorbel et al. (2000), quienes trabajaron
con un sistema de transformación basado en A.
tumefaciens.
La eficiencia de generación de brotes a partir de segmentos de raíz transformada obtenida en naranjo agrio
es inferior a la observada en limón mexicano (PérezMolphe-Balch y Ochoa-Alejo, 1998), donde 41% de
segmentos de raíz produjeron brotes, con un promedio
de 2.17 brotes por explante. Por otra parte, los segmentos
de raíz transformada inoculados en posición horizontal
635
Cuadro 1. Efecto del tiempo de cocultivo y de la concentración
bacteriana en la producción de raíces transformadas en segmentos de tallo de naranjo agrio.
Table 1. Effect of co-culture time and bacterial concentration
on production of transformed roots in sour orange
stem segments.
Tiempo de
cocultivo (h)
Concentración de
la bacteria,
células (mL−1)
% de explantes
con raíces
1×10 7
1×10 8
1×10 9
1×10 7
1×10 8
1×10 9
1×10 7
1×10 8
1×10 9
22.7
18.5
50.0
30.0
35.8
32.8
66.5
91.0
17.0
48
48
48
72
72
72
96
96
96
Raíces por
explante,
media±DE†
1.7
2.0
1.8
3.0
3.4
2.5
3.3
3.6
1.0
±
±
±
±
±
±
±
±
±
0.67 b
0.10 b
0.83 b
1.68 ab
1.50 a
1.20 ab
0.92 a
0.67 a
0.3 b
†
Medias con diferente letra en una columna son diferentes (Tukey,
p≤0.05) ❖ Means with different letter in a row, are different
(Tukey, p≤0.05).
compound were added to bacterial suspension, although
200 µM showed an inhibitory effect (Table 2). This same
phenomenon has already been reported for other A.
rhizogenes-transformed species. In Brassica oleracea var.
italica, frequency of explants with transformed roots is
increased when using 50 mM acetosyringone, but this
value is decreased when increasing concentration to
100 mM (Henzi et al., 2000). Number of roots per explant
showed no significant differences among the four
concentrations of acetosyringone (Table 2).
Transformed roots kept in the dark exhibited greater
growth (6.7±1.5 cm in 30 d), in comparison to the ones
incubated under continuous light, which only grew
0.7±0.15 cm in the same period; this difference was
significant according to the Mann-Whitney test. Despite
displaying less growth, the roots incubated under
continuous light stayed vigorous and turned green due
to chlorophyll synthesis.
Cuadro 2. Efecto de la acetosiringona en la producción de
raíces transformadas a partir de segmentos de tallo
de Naranjo agrio.
Table 2. Effect of acetosyringone on transformed root
production from sour orange stem segments.
Acetosiringona,
µM
0
50
100
200
†
% de explantes
con raíces
45.2
83.2
56.0
25.0
Raíces por explante,
media±DE †
1.10
1.57
1.07
1.00
No hubo diferencias significativas (Tukey, 0.05)
no significant differences (Tukey, 0.05).
❖
±
±
±
±
0.10
0.13
0.08
0.00
There were
636
AGROCIENCIA VOLUMEN 37, NÚMERO 6, NOVIEMBRE-DICIEMBRE 2003
no produjeron brotes en ningún tratamiento. Sólo se
observó la aparición de tejido calloso en algunos de
ellos, pero a los 60 d todos habían muerto. Los brotes
mayores de 15 mm fueron recolectados y transferidos a
medio sin reguladores del crecimiento, donde 55% creció y formó raíces, mientras que el 45% restante detuvo
su desarrollo y sufrió necrosis. La eficiencia de
enraizamiento obtenida en este trabajo puede considerarse alta y satisfactoria, ya que la baja tasa de
enraizamiento de los brotes transgénicos es una de las
principales limitaciones de los sistemas de transformación de cítricos basados en A. tumefaciens (Gutiérrez et
al. 1997). Las plántulas mayores de 50 mm y con un
sistema radical vigoroso se transfirieron a suelo (mezcla
comercial de suelo estéril para macetas) y fueron mantenidas primero en una cámara bioclimática y luego en
invernadero (Figura 1e). Algunas de las plantas mostraron un fenotipo alterado, con entrenudos cortos, hojas
arrugadas y sistema radical muy desarrollado. La introducción de los genes rol de A. rhizogenes produce, en
algunos casos, cambios fenotípicos, como el incremento en la capacidad de generar raíces y la reducción en el
tamaño de la planta, alteraciones atractivas cuando se
presentan en materiales usados como portainjertos
(Christey, 2001), como en el naranjo agrio. Finalmente,
el sistema de transformación desarrollado fue utilizado
para la introducción del gen que codifica para la proteína de la cápside del VTC en tejidos de naranjo agrio; se
obtuvieron tanto raíces (Figura 1f) como brotes (Figura
1g) transformados con dicho gen.
Regeneration of adventitious shoots from
transformed roots
Transformed root segments inoculated up-right
started to generate adventitious shoots on the upper end
15-30 d after transfer to two of the three regeneration
media tested (Table 3) (Figure 1c). The highest frequency
of shoot-generating explants was observed in medium
with 5.0 mg L−1 BA and 1.0 mg L−1 ANA. Mean number
of shoots per explant did not show significant difference
between the two treatments that produced shoots. In the
treatment with 10.0 mg L−1 BA and 2.0 mg L−1 ANA no
response was observed at all, probably due to toxicity
on tissues caused by such high concentrations of growth
regulators. The efficiency of the BA-ANA combination
for generation of transformed shoots in sour orange has
been reported by Ghorbel et al. (2000), who worked with
an A. tumefaciens -based transformation system.
The efficiency of shoot generation from transformed
root segments obtained for sour orange is lower to that
observed in Mexican lime (Pérez-Molphe-Balch &
Ochoa-Alejo, 1998), where 41% of root segments
produced shoots, with a mean of 2.17 shoots per explant.
On the other hand, transformed root segments inoculated
horizontally did not produce shoots in any treatment.
Only the formation of callous tissue was observed in
some of them, but all were dead after 60 d. Shoots longer
than 15 mm were collected and transferred to medium
without growth regulators, where 55% grew and
produced roots, while the remaining 45% arrested
development and underwent necrosis. The rooting
efficiency achieved in this study is considered high and
satisfactory, since the low ratio of rooting in transgenic
shoots is one of the major constraints to A. tumefaciensbased citrus transformation systems (Gutiérrez et al.
1997). Seedlings longer than 50 mm and with a vigorous
radical system were transferred to soil (commercial mix
of sterile soil) and kept first in a bioclimatic chamber
and then under greenhouse conditions (Figure 1e). Some
of the plants exhibited an altered phenotype, with short
internodes, wrinkled leaves and over-developed radical
system. The introduction of rol genes of A. rhizogenes
produce phenotypic changes in some cases, such as an
Caracterización de los tejidos transformados
El crecimiento de las raíces en el medio de selección
sin reguladores del crecimiento es ya una primera evidencia de la transformación. Para confirmarlo, se hicieron ensayos histoquímicos para detectar la actividad de
gus en todos los materiales generados, así como pruebas
de PCR y Southern blot en una muestra de los mismos.
De las líneas de raíces presuntamente transformadas, 80%
mostraron actividad de gus (Figura 1b). En cuanto a los
brotes generados a partir de las mismas, 100% mostró
actividad de gus (Figura 1d). Estos resultados contrastan
Cuadro 3. Regeneración de brotes adventicios en segmentos de raíz de naranjo agrio transformada con la cepa A4/pESC4,
cultivados en posición vertical en tres medios con BA y ANA.
Table 3. Regeneration of adventitious shoots in sour orange root segments transformed with strain A4/pESC4, cultured in up-right
position in three BA-ANA containing media.
Tratamiento (reguladores
del crecimiento en mg L−1)
2.5 BA + 0.5 ANA
5.0 BA + 1.0 ANA
10.0 BA + 2.0 ANA
% de segmentos de raíz que
generaron brotes adventicios
5.2
18
0
Brotes adventicios por segmento
de raíz (media±DE)
1.12 ± 0.186
1.25 ± 0.162
0
CHÁVEZ-VELA et al.: TRANSFORMACIÓN GENÉTICA DEL NARANJO AGRIO USANDO Agrobacterium rhizogenes
con los obtenidos al utilizar un sistema de transformación basado en A. tumefaciens, con el que se reporta
2.4% de brotes positivos para GUS en naranjo agrio
(Gutiérrez et al., 1997). Los resultados con PCR fueron
positivos, ya que se amplificaron fragmentos de 780,
517 y 1200 pb, correspondientes a los genes rolB, nptII
y gus, en el ADN proveniente de una muestra de hojas
gus positivas de plántulas transformadas con el plásmido
ESC4. No se observó el fragmento de 450 pb correspondiente al gen virD1, por lo que se descarta que estos
resultados hayan sido producto de la contaminación con
A. rhizogenes (Figura 2a). El análisis Southern blot mostró la presencia de una señal de alrededor de 10 kb, que
corresponde al gen nptII, en el ADN proveniente de cuatro líneas analizadas de raíces transformadas (Figura 2b).
Finalmente, se analizaron mediante PCR seis líneas de
raíces y cinco de hojas de plántulas transformadas con
B249CP-pGA482GG, amplificándose en todas una banda de 720 pb, correspondiente a un fragmento del gen de la
cápside del VTC (Figura 2c). Estas pruebas confirman la
naturaleza transgénica de las raíces y plantas generadas.
CONCLUSIONES
Se desarrolló un sistema para la transformación
genética del naranjo agrio usando Agrobacterium
rhizogenes como vector. La mayor eficiencia se obtuvo
al cocultivar segmentos internodales por 96 h con una
suspensión bacteriana a una densidad de 1×108 células
mL−1. La adición de acetosiringona (50 µM) a la suspensión bacteriana tuvo un efecto benéfico en la eficiencia de transformación. Las raíces transformadas mostraron un mayor crecimiento al ser mantenidas en la obscuridad. La regeneración de brotes adventicios a partir
de las raíces transformadas se logró inoculando segmentos de 10 mm de longitud en posición vertical en medio
adicionado con 5 mg L−1 de BA combinados con 1.0 mg
L−1 de ANA. Este sistema se utilizó para introducir el
gen que codifica para la proteína de la cápside del VTC
en el naranjo agrio. Las plantas que expresan este gen
podrían mostrar una mayor resistencia a la infección con
este virus, como se ha observado en otras especies vegetales transformadas con cápsides virales (ReimannPhilipp, 1998).
AGRADECIMIENTOS
Los autores agradecen el apoyo financiero de la Universidad
Autónoma de Aguascalientes (PIB-98-3 y PIBT-00-1) y del Consejo Nacional de Ciencia y Tecnología (31426-B). A este último se
le agradece también las becas de posgrado otorgadas a N. ChávezVela y L. Chávez-Ortiz. Asimismo, agradecen a la Dra. June
Simpson del CINVESTAV y al Dr. C.L. Niblett, de la Universidad
de Florida, por proporcionar los plásmidos ESC4 y B249CPpGA482GG, respectivamente, y al MC. Manuel Robles González,
637
increase in root generating capability and reduction of
plant size; these alterations may be desirable when they
appear in materials used as rootstocks (Christey, 2001),
as for sour orange. Finally, the transformation system
developed was used to introduce the gene that codes for
the CTV capsid protein into sour orange tissues. Both
roots (Figure 1f) and shoots (Figure 1g) transformed with
the gene were obtained.
Characterization of transformed tissues.
Root growth in selection medium without growth
regulators is already a first evidence of transformation.
In order to verify it, histochemical assays for the
detection of gus activity were carried out in all generated
materials, as well as PCR and Southern blot tests in a
sample of them. Eighty percent of the putatively
transformed lines showed gus activity (Figure 1b).
Regarding shoots generated from these lines, 100%
displayed gus activity (Figure 1d). These results differ
from the ones obtained with an A. tumefaciens-based
transformation system, where 2.4% of gus positive shoots
is reported for sour orange (Gutiérrez et al. 1997). PCR
results were positive, since 780, 517 and 1200 bp
fragments were amplified, matching the rolB, nptII and
gus genes, in a DNA sample from gus positive leaves
from seedlings transformed with the ESC4 plasmid. The
450 bp fragment corresponding to the virD1 gene was
not found; so, the possibility that the results had been
caused by contamination with A. rhizogenes is discarded
(Figure 2a). Southern blot analysis showed the presence
of a signal of around 10 kb, corresponding to the nptII
gene; in DNA from four lines of transformed roots (Figure
2b). Finally, PCR analysis was performed on six lines of
roots and five of leaves from seedlings transformed with
B249CP-pGA482GG; in all of them, a 720 bp band was
amplified, which matches a fragment of the CTV capsid
protein (Figure 2c). These tests confirm the transgenic
nature of the roots and plants generated.
CONCLUSIONS
A genetic transformation system for sour orange was
developed using Agrobacterium rhizogenes as
transformation vector. The greatest efficiency was
attained with co-culture of internodal segments for 96 h
with a bacterial suspension of density 1×108 cells mL−1.
The addition of acetosyringone (50 µM) to the bacterial
suspension had a beneficial effect on the efficiency of
transformation. Transformed roots displayed greater
growth when kept in the dark. The regeneration of
adventitious shoots from transformed roots was achieved
by inoculation of 10 mm long segments in up-right
position, in medium containing 5 mg L−1 BA combined
638
AGROCIENCIA VOLUMEN 37, NÚMERO 6, NOVIEMBRE-DICIEMBRE 2003
1
2
3
4
1
5
2
3
4
pb
kb
1000
10
500
a
b
1
2
3
4
5
6
7
8
9
10
11
12
13
pb
720
c
Figura 2. a) Análisis PCR para verificar la presencia de los genes foráneos en ADN extraído de hojas de una planta de naranjo agrio
transformada con el plásmido ESC4. Los genes amplificados fueron: Carril 1, rolb; Carril 2, nptII; Carril 3, gus; Carril
4, vird1; carril 5, marcador de peso molecular; b) Análisis Southern blot que demuestra la presencia del gen nptII en ADN
genómico de cuatro líneas de raíces de naranjo agrio transformadas con el plásmido ESC4. c) Análisis PCR para verificar
la presencia del gen de la cápside del VTC en raíces y brotes de naranjo agrio transformados con el plásmido B249CPpGA482GG. Carril 1: ADN de raíz no transformada. Carril 2: ADN de hoja no transformada. Carriles 3-8: ADN
extraído de seis líneas de raíces transformadas. Carriles 9-13: ADN extraído de hojas de cinco brotes regenerados a partir
de segmentos de raíz transformada.
Figura 2. a) PCR analysis for confirmation of presence of foreign genes in DNA extracted from leaves from a pESC4- transformed
sour orange plant. Amplified genes were: Lane 1, rolb; Lane 2, nptII; Lane 3, gus; Lane 4, vird1; Lane 5, molecular weight
markev. b) Southern blot analysis that shows presence of nptII gene in genomic DNA from four lines of sour orange roots
transformed with plasmid ESC4. c) PCR analysis to confirm the presence of CTV capsid gene in sour orange roots and
shoots transformed with plasmid B249CP-pGA482GG. Lane 1: Untransformed root DNA. Lane 2: Untransformed leaf
DNA. Lanes 3-8: DNA extracted from six lines of transformed roots. Lanes 9-13: DNA extracted from leaves from five
shoots regenerated from transformed root segments.
investigador del INIFAP Colima, por proporcionar el material
vegetal utilizado en la investigación.
LITERATURA CITADA
Cervera, M., J. A. Pina, J. Juárez, L. Navarro, and L. Peña. 1998a.
Agrobacterium-mediated transformation of citrange: factors
with 1.0 mg L−1 ANA. This system was used to insert the
gene that codes for the CTV capsid protein into sour
orange. Plants expressing this gene could show greater
resistance to infection by this virus, as has been observed
in other plant species transformed with virus capsids
(Reimann-Philipp, 1998).
CHÁVEZ-VELA et al.: TRANSFORMACIÓN GENÉTICA DEL NARANJO AGRIO USANDO Agrobacterium rhizogenes
affecting transformation and regeneration. Plant Cell Reports
18: 271-278.
Cervera, M., J. Juárez, A. Navarro, J.A. Pina, N. Duran-Vila, L.
Navarro, and L. Peña. 1998b. Genetic transformation and
regeneration of mature tissues of woody fruit plants bypassing
the juvenile stage. Transgenic Research 7:51-59.
Christey, M.C. 2001. Use of Ri-mediated transformation for
production of transgenic plants. In Vitro Cellular and
Developmental Biology - Plant 37:687-700.
Durón-Noriega, J., B. Valdez-Gazcón, J.H. Núñez-Moreno, y G.
Martínez. 1999. Cítricos para el Noroeste de México. INIFAP.
México. 155 p.
Draper, J. and R. Scott. 1988. The isolation of plant nucleic acids.
In: Plant genetic transformation and gene expression. A
laboratory manual. Draper J., R., Scott, P. Armitage, R. Walden
(eds). Blackwell Scientific Publications, Oxford, pp: 199-236.
Edwards, K., C. Johnstone, and C. Thompson. 1991. A simple
and rapid method for the preparation of plant genomic DNA
for PCR analysis. Nucleic Acids Research 19:1349.
Ghorbel, R., A. Domínguez, L. Navarro, and L. Peña. 2000. High
efficiency genetic transformation of sour orange (Citrus
aurantium) and production of transgenic trees containing the
coat protein gene of citrus tristeza virus. Tree Physiol. 20:11831189.
Gutiérrez-E., M.A., D. Luth, and G.A. Moore. 1997. Factors
affecting Agrobacterium-mediated transformation in Citrus
and production of sour orange (Citrus aurantium L.) plants
expressing the coat protein gene of citrus tristeza virus. Plant
Cell Reports 16:745-753.
Hamill, J.D., S. Rounsley, A. Spencer, G. Todd, and M.J.C. Rhodes.
1991. The use of the polymerase chain reaction in plant
transformation studies. Plant Cell Reports 10:221-224.
Henzi, M.X., M.C. Christey and D.L. McNeil. 2000. Factors that
influence Agrobacterium-rhizogenes mediated transformation
of broccoli (Brassica oleracea L. var. italica). Plant Cell
Reports 19:994-999.
639
Hooykaas, P.J.J., P.M. Klapwjik, M.P. Nuti, R.A. Schilperoot, and
A. Horsch. 1977. Transfer of the A. tumefaciens Ti plasmid to
avirulent Agrobacteria and Rhizobium ex planta. J. Genetic
Microbiol. 98:477-484.
Jofre-Garfias, A.E., N. Villegas-Sepúlveda, J.L. Cabrera-Ponce,
R.M. Adame-Alvarez, L. Herrera-Estrella, and J. Simpson.
1997. Agrobacterium-mediated transformation of Amaranthus
hypochondriacus: light- and tissue-specific expression of pea
chlorophyll a/b-binding protein promoter. Plant Cell Reports
16:847-852.
Murashige, T., and F. Skoog, 1962. A revised medium for rapid
growth and bioassay with tobacco tissue culture. Physiologia
Plantarum 15:473-479.
Orozco-Santos, M. 1996. Enfermedades Presentes y Potenciales
de los Cítricos en México. Universidad Autónoma Chapingo,
México. 150 p.
Peña, L., M. Cervera, J. Juárez, A. Navarro, J.A. Pina, N. DuránVila, and L. Navarro. 1995. Agrobacterium-mediated
transformation of sweet orange and regeneration of transgenic
plants. Plant Cell Reports 14: 616-619.
Peña, L., and L. Navarro. 1999. Transgenic citrus. In:
Biotechnology in Agriculture and Forestry, Vol. 44 Transgenic
Trees. Bajaj, Y.P.S., (ed.). Springer-Verlag, Berlin-Heilderberg.
pp: 39-54.
Pérez-Molphe-Balch, E. and N. Ochoa-Alejo. 1998. Regeneration
of transgenic plants of Mexican lime from Agrobacterium
rhizogenes transformed tissues. Plant Cell Reports 17:591596.
Reimann-Philipp, U. 1998. Mechanisms of resistance: Expression
of coat protein. In: Plant Virology Protocols: From Virus
Isolation to Transgenic Resistance. Foster, G.D. and S.C. Taylor
(eds). Humana Press, Towota, New Jersey. pp: 521-532.
Rocha-Peña, M.A., R.F. Lee, R. Lastra, C.L. Niblett, F.M. OchoaCorona, S.M. Garnsey, and R.K. Yokomi. 1995. Citrus Tristeza Virus and its aphid vector Toxoptera citricida. Threats to
citrus production in the Caribbean and Central and North
America. Plant Disease 79:437-445.