2009-Co-regulation of ocular dominance plasticity and NMDA receptor subunit expression

2857
J Physiol 587.12 (2009) pp 2857–2867
Co-regulation of ocular dominance plasticity and NMDA
receptor subunit expression in glutamic acid
decarboxylase-65 knock-out mice
Patrick O. Kanold1,2 , Yoon A. Kim1,3 , Tadzia GrandPre1 and Carla J. Shatz1,3
1
Department of Neurobiology, Harvard Medical School, Boston, MA 02115, USA
Department of Biology, Institute for Systems Research, University of Maryland, 1116 Biosciences Research Bldg, College Park, MD 20742, USA
3
Bio-X, James H. Clark Center, 318 Campus Drive W1.1, Stanford University, Stanford, CA 94305-5437, USA
2
Experience can shape cortical circuits, especially during critical periods for plasticity. In visual
cortex, imbalance of activity from the two eyes during the critical period shifts ocular dominance
(OD) towards the more active eye. Inhibitory circuits are crucial in this process: OD plasticity
is absent in GAD65KO mice that show diminished inhibition. This defect can be rescued by
application of benzodiazepines, which increase GABAergic signalling. However, it is unknown
how such changes in inhibition might disrupt and then restore OD plasticity. Since NMDA
dependent synaptic plasticity mechanisms are also known to contribute to OD plasticity, we
investigated whether NMDA receptor levels and function are also altered in GAD65KO. There
are reduced NR2A levels and slower NMDA currents in visual cortex of GAD65KO mice.
Application of benzodiazepines, which rescues OD plasticity, also increases NR2A levels. Thus it
appears as if OD plasticity can be restored by adding a critical amount of excitatory transmission
through NR2A-containing NMDA receptors. Together, these observations can unify competing
ideas of how OD plasticity is regulated: changes in either inhibition or excitation would engage
homeostatic mechanisms that converge to regulate NMDA receptors, thereby enabling plasticity
mechanisms and also ensuring circuit stability.
(Received 18 February 2009; accepted after revision 17 April 2009; first published online 30 April 2009)
Corresponding author C. J. Shatz: Bio-X, James H. Clark Center, 318 Campus Drive W1.1, Stanford University, Stanford,
CA 94305-5437, USA. Email: cshatz@stanford.edu
Abbreviations BZ, binocular zone; DE, deprived eye; LTD, long-term depression; LTP, long-term potentiation; MD,
monocular deprivation; ME, monocular enucleation; MZ, monocular zone; NDE, non-deprived eye; OD, ocular
dominance.
In their pioneering work, Hubel and Wiesel showed that
in animals with binocular vision, projections from the
visual thalamus (lateral geniculate nucleus, LGN) to the
visual cortex are organized in eye-specific regions of ocular
dominance (OD) that are shaped by visual experience,
especially during a critical period in early development
(Wiesel & Hubel, 1963; Hubel & Wiesel, 1969; Wiesel et al.
1974; Hubel et al. 1977) These studies as well as more
recent experiments exploring molecular underpinnings of
the critical period have shown that decreasing activity in
one eye (monocular deprivation, MD), leads to weakening
and removal of connections from the deprived eye (DE)
and strengthening and expansion of connections from the
non-deprived eye (NDE): this is OD plasticity (Antonini
& Stryker, 1993; Antonini et al. 1999; Sawtell et al. 2003;
Frenkel & Bear, 2004; Hensch, 2004; Tagawa et al. 2005).
Recent work in mice lacking an isoform of glutamic
acid decarboxylase (GAD65; a GABA producing enzyme)
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
(GAD65KO) points to a crucial role for inhibitory circuits
in regulating OD plasticity (Hensch et al. 1998; Fagiolini
& Hensch, 2000; Klausberger et al. 2002; Fagiolini et al.
2004; Katagiri et al. 2007). GAD65KO mice do not show
an OD shift when one eye is deprived of vision during
the critical period (Hensch et al. 1998). OD plasticity
in GAD65KO can be reestablished by application of
diazepam, a benzodiazepine that increases flux through
the GABA A receptor (Hensch et al. 1998). Application
of diazepam at ages when GABAergic circuits are still
immature (weak) allows for OD plasticity even before the
normal onset of the critical period (Fagiolini & Hensch,
2000). In addition, early maturation of inhibitory circuits
has been linked to an early opening followed by premature
closing of the critical period (Hanover et al. 1999; Huang
et al. 1999). Together these experiments suggest that a
critical threshold of inhibition is necessary for the critical
period to commence.
DOI: 10.1113/jphysiol.2009.171215
2858
P. O. Kanold and others
How then does inhibition influence the synaptic
rearrangements underlying OD plasticity? Multiple lines
of evidence suggest that the experience-dependent tuning
of visual cortical circuits during the critical period depends
on NMDA-dependent mechanisms of synaptic plasticity
such as long-term potentiation (LTP) and long-term
depression (LTD), both of which exist in visual cortex
(Kirkwood & Bear, 1994, 1995; Kirkwood et al. 1995;
Bear & Rittenhouse, 1999; Malenka & Bear, 2004). The
functional properties of NMDA receptors are determined
by the expression ratios of the NR2A and NR2B subunits. Both age and experience regulate these levels
(Carmignoto & Vicini, 1992; Quinlan et al. 1999a,b;
Roberts & Ramoa, 1999), and they also change the
induction properties of LTP and LTD, as well as OD
plasticity (Philpot et al. 2001; Sawtell et al. 2003).
Since both NMDA and GABA receptors are regulated
by manipulations that also influence OD plasticity, we
hypothesized that manipulations of GABAergic function
that are known to affect OD plasticity, such as occurs
in the GAD65KO, might also engage NMDA-dependent
mechanisms. It is well established that the levels of
excitation and inhibition in neuronal networks are
co-regulated by homeostatic mechanisms (Turrigiano,
1999), and homeostatic mechanisms are also thought
to be engaged following monocular visual deprivation
(Mrsic-Flogel et al. 2007). Thus, reducing GABA release,
as occurs in the GAD65KO mice, might elicit a homeostatic readjustment of excitatory NMDA transmission
and thereby affect plasticity mechanisms. Evidence that
inhibitory GABAergic and excitatory NMDA transmission
can be co-regulated comes from studies showing that
manipulations that alter OD plasticity also alter both
NMDA and GABA receptors (Carmignoto & Vicini, 1992;
Huang et al. 1999; Quinlan et al. 1999a,b; Roberts &
Ramoa, 1999; Morales et al. 2002; Jiang et al. 2005).
These experiments suggest that there might be an
underlying common requirement for a critical balance
between excitation and inhibition in OD plasticity. Here
we explore this suggestion by examining NMDA and
GABA receptor levels in GAD65KO and the effects of
diazepam on both transmitter systems. Our results show
that NR2A-containing NMDA receptors are regulated
by inhibition, consistent with the idea that the relative
expression ratio of NR2A to NR2B correlates with, and
may be a crucial determinant of, the ability to induce OD
plasticity.
Methods
GAD65KO
mice
on
C57/Bl6
background
(B6.129x1-Gad2/J) were obtained from The Jackson
Laboratory (Bar Harbor, ME, USA). Heterozygous
(+/−) mice were bred and −/− (KO) and +/+ (WT)
littermates were compared. All procedures were approved
J Physiol 587.12
by the Harvard Medical School Animal Care and Use
Committee.
In situ hybridizations
Animals were killed with an I.P. overdose of sodium
pentobarbital (200 mg kg−1 to effect) and the brains were
rapidly removed and frozen in cryoprotective medium
(M1, Shandon, Thermo Electron Corporation, Waltham,
MA, USA). Horizontal sections were cut (12–15 μm)
on a cryostat. In situ hybridizations are performed as
described previously (Kanold et al. 2003; Tagawa et al.
2005). Template sequences were generated from full
length Arc clone (gift from P. Worley, Johns Hopkins
University, MD, USA). 35 S-labelled riboprobes were
generated by in vitro transcription. After hybridization,
sections were processed, dipped with autoradiographic
emulsion (Kodak NTB-2) and exposed for 3–6 weeks.
Darkfield images were acquired with a CCD camera
(Spot). The borders between layers were chosen according
to adjacent cresyl violet stained sections. Sense probes
yielded only background levels of signal (Tagawa et al.
2005; Syken et al. 2006).
Densitometric scans of Arc induction in specific
cortical layers
Quantitative analysis of Arc expression was performed
in MATLAB (The Mathworks, Inc., Natick, MA, USA)
by line scans in layer 4 as described previously (Tagawa
et al. 2005; Syken et al. 2006). Five to fifteen sections from
each animal were scanned. The analyses were performed
blind to genotype and manipulation; slides from different
animals and manipulations were interleaved with each
other and only reassembled once they were decoded. For
each section, a line was generated along the centre of
the chosen layer by selecting 20–100 points, and then
performing a cubic spline interpolation between these
points. At every pixel along this line, a perpendicular line
through the layer (30–60 pixels long; 1 pixel = 1.75 μm)
was computed and the average signal intensity of pixels
along this line was measured. The resulting intensity line
scan was low pass filtered (7 pt triangular), generating a
curve of Arc signal intensity versus distance along the layer
of interest. Arc signal rose from a minimum in both V1
and V2 to a maximum within the binocular zone (BZ).
The width of the BZ, encompassing binocular regions
in V1 and V2, was measured as the region around the
intensity maximum in which signal intensity is greater
than 2 standard deviations of the Arc background signal
intensity (determined as average intensity of 30 pixels in
the region of minimum Arc induction outside the BZ; this
method would if anything underestimate BZ width). The
area of V1 and V2 in which Arc induction is at a minimum
is defined as the monocular zone (MZ).
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
J Physiol 587.12
NMDA receptors and OD plasticity in GAD65KO mice
Real-time quantitative PCR analyses
RT-qPCR was performed as described previously (Tagawa
et al. 2005; Kanold & Shatz, 2006). Mice were killed
and brains removed. V1 and V2 were microdissected
from coronal 2 mm-thick brain slices cut on an acrylic
matrix (Ted Pella, Inc., Redding, CA, USA) and frozen
immediately on dry ice. Total RNA was isolated using
Ambion RNAqueous-Micro cDNA Synthesis Kit (cat.
no. 1931, Ambion, Inc., Austin, TX, USA). cDNA was
synthesized using the iscript cDNA synthesis kit (Bio-Rad
cat. no. 170-8891). A reaction mix contained 1X iQ
SYBR Green Supermix (Bio-Rad Laboratories, CA, USA),
100 nM each oligonucleotide primers and 10 ng of cDNA
in a 25 μl total volume. The relative amount of mRNA
was normalized to the level of internal control message,
hypoxanthine phosphoribosyltransferase (HPRT).
HPRT(nm_013556) Fwd: TGCTCGAGATGTCATGAAGG, Rev: TATGTCCCCCGTTGACTGAT. GABA A
α1 (m86566) Fwd: CCCGTTCAGTGGTTGTAGCA,
Rev: CTCTGTTGAGCCAGAAGGAGAC KCC2 (nm_
020333)
Fwd:
GTGCCCAGGTAGAAGCAGAG
Rev: CACAGCCATTTCCATGAGTG NR2A (nm_
008170) Fwd: CAACGAAGGGATGAATGTGA Rev:
ACAAAGGGCACGGAGAAGT NR2B (nm_008170)
Fwd: TGCTACAACACCCACGAGAA Rev: CTCCTCCAAGGTAACGATGC
Real-time PCR data analysis was performed according
to the comparative threshold cycle (C T ) method.
Differences in threshold crossing cycle between mRNA
of target gene and HPRT (= Dgene) were calculated for
each condition. Then the levels of mRNA expression were
computed as 2(Dgene) . Individual animal samples were run
in triplicate at each reaction on a 96-well plate allowing
us to run 32 samples simultaneously. For comparison
each run contained either WT and KO or WT and
KO+diazepam samples and we always compared our gene
of interest (i.e. NR2A) and our internal control (HPRT)
in the same run. We found that this experimental scheme
allowed us the highest sensitivity. Thus, each run contained
16 distinct measurements. We then performed paired
comparisons of our three conditions.
Western blots
Mouse brains were dissected and homogenized in
approximately 10 volumes of ice cold buffer containing 1%
NP40, 150 mM NaCl, 50 mM Tris (pH 7.4), 1 mM sodium
fluoride, 1 mM sodium fluoride, 1 mM sodium vanadate,
and protease inhibitors (Roche inhibitor cocktail).
Samples were centrifuged at 13 000 rpm and diluted in
SDS sample buffer. Samples were separated by SDS-PAGE,
transferred to PVDF or nitrocellulose membranes, probed
with the appropriate antibody (NR2A, NR2B, GAD65,
GABAAα1 from Upstate Biotechnology, Inc. (Lake Placid,
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
2859
NY, USA) and ERK from Cell Signaling Technology,
Inc. (Beverly, MA, USA)), and visualized with enhanced
chemilumenesence (Pierce Biotechnology, Inc., Rockford,
IL, USA) and Kodak XAR-5 film using multiple exposures.
Protein levels were measured by scanning the film and
quantifying the optical density of a equal sized region
encompassing each band and subtracting background
level. To normalize for loading differences, receptor
protein levels were then normalized to ERK. Paired
samples for KO and WT comparison or KO+diazepam
and WT comparison were run on the same gel and protein
levels in each gel were normalized to the average WT levels
for that gel.
OD plasticity experiments and diazepam application
Animals were deeply anaesthetized with 4% isofluorane (Halocarbon), and monocular enucleation (ME)
performed at P25 under aseptic conditions as described
previously (Tagawa et al. 2005; Syken et al. 2006). ME at the
ages and for the periods of time used here (∼10 days) does
not change the spatial pattern of LGN activation but results
in robust OD shifts in visual cortex (Tagawa et al. 2005).
ME is well suited for Arc induction experiments as it yields
a robust intraocular activity imbalance in the induction
phase compared to MD where light can penetrate the
closed eyelid and increase activity in connected circuits.
Thus ME enhances the signal to noise ratio compared to
MD. For rescue experiments, diazepam (30 mg kg−1 ) was
injected I.P. with a 30g needle once a day for 4 days starting
at P23/24 (Hensch et al. 1998; Huopaniemi et al. 2004).
Electrophysiology
Animals were killed and a block of brain containing visual
cortex was removed rapidly. Slices (350–450 μm) were cut
on a vibrating microtome in ice cold ACSF containing (in
mM): 130 NaCl, 3 KCl, 1.25 KH 2 PO 4 , 20 NaHCO 3 , 10
glucose, 1.3 MgSO 4 , 2.5 CaCl 2 (pH 7.35–7.4, equilibrated
with 95% O 2 –5% CO 2 ). They were incubated for at least
1 h in ACSF at 30◦ C. For recording, slices were held in
a chamber on a fixed stage microscope and superfused
(2–4 ml min−1 ) with ACSF at ∼25◦ C. Recordings were
performed with a patch clamp amplifier (Multiclamp
700B) in voltage clamp using pipettes (4–8 M) filled
with (in mM): 115 CsMeSO4, 5 NaF, 10 GTP, 10 Hepes,
15 CsCl, 3.5 Mg-ATP, 3 QX-314. NMDA currents were
isolated by holding neurons at +40 mV and blocking
GABAergic transmission with picrotoxin (100 μM) and
AMPA receptors with CNQX or NBQX (10 μm). Signals
were digitized by a Digidata AD board under pCLAMP
(Molecular Devices) and NMDA currents are analysed
using MATLAB.
2860
P. O. Kanold and others
Statistics
Means were compared with Student’s t-test and deemed
significant if P < 0.05.
Results
OD plasticity typically has been induced by monocular
visual deprivation (MD) (Wiesel & Hubel, 1963; Hubel
et al. 1977; Shatz & Stryker, 1978; Antonini & Stryker,
1993; Antonini et al. 1999; Sawtell et al. 2003; Frenkel
& Bear, 2004; Hensch, 2004; Tagawa et al. 2005). OD
plasticity can be measured as a physiological shift in the
responsiveness of neurons towards the non-deprived eye
(NDE) and also as an anatomical expansion of the cortical
territory corresponding to the NDE (Wiesel & Hubel,
1963; Hubel et al. 1977; Shatz & Stryker 1978; Antonini
J Physiol 587.12
& Stryker, 1993; Antonini et al. 1999; Sawtell et al. 2003;
Frenkel & Bear, 2004; Hensch, 2004; Tagawa et al. 2005).
The mouse visual cortex receives functional inputs from
both eyes (Fig. 1A) (Hubener, 2003). Most of the visual
cortex consists of a large monocular zone (MZ) where
neurons are visually responsive exclusively to the contralateral eye. A more restricted region, the binocular zone
(BZ), receives functional inputs from both ipsilateral and
contralateral eyes and thus neurons respond to stimulation
of both eyes (Hubener, 2003; Niell & Stryker, 2008). As
in other mammals, MD in mice during a critical period
results in an ocular dominance shift towards the NDE
(Hensch et al. 1998; Cang et al. 2005; Tagawa et al. 2005;
Mrsic-Flogel et al. 2007). OD shifts can also be induced
by creating an activity imbalance between the two eyes by
means of TTX injections or monocular eye removal (ME)
(Chapman et al. 1986; Frenkel & Bear, 2004; Tagawa et al.
Figure 1. Arc induction method reveals expected lack of OD plasticity and diazepam rescue in GAD65KO
mice
A, schematic cartoon of mouse visual system. Binocular zone (BZ) is located at the border between primary (V1)
and secondary (V2) visual cortex. ‘Arc’ indicates the area of Arc induction by ipsilateral eye stimulation. B, in
situ hybridization showing pattern of Arc mRNA induction at P35 in GAD65KO mice following monocular visual
stimulation of the ipsilateral eye. Shown in situ from 3 different experimental conditions: normally reared (NR)
GAD65KO animals; following 10 day monocular enucleation (ME) between P25 and P35; and ME between P25
and P35 plus chronic application (4 days) of diazepam (ME+DZ) between P24 and P27. Arrows indicate the extent
of the BZ. Note that a expansion of the Arc mRNA signal – indicating intact OD plasticity – is only observed
in the ME+diazepam condition (ME+DZ). C, quantification of the width of the Arc induction in layer 4 by the
ipsilateral eye at P35. ME in WT animals (ME) results in expansion of the ipsilateral eye patch (1576 ± 220 μm
n = 11 vs. 1147 ± 84 μm, n = 8, P = 0.00001). Ipsilateral eye patch is similar in normally reared (NR) KO and
WT (1121 ± 101 μm, n = 8, P = 0.6). There is no expansion of the ipsilateral eye patch in GAD65KO following
ME (1197 ± 119 μm, n = 6, P = 0.22), but 4 days’ application of diazepam rescues expansion of the ipsilateral
eye following ME in KO mice (ME+DZ) (1478 ± 158 μm, n = 9, P = 0.00014) similar to ME in WT (P = 0.29).
Horizontal grey bar indicates range (mean ± S.D.) of WT.
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
J Physiol 587.12
NMDA receptors and OD plasticity in GAD65KO mice
2005); however the extent of plasticity is thought to be
different (Frenkel & Bear, 2004; Tagawa et al. 2005).
OD shifts can be measured using various methods
ranging from single unit microelectrode recording and
intrinsic signal imaging to immediate early gene induction
using Arc or cfos (Hensch et al. 1998; Pham et al. 2004;
Cang et al. 2005; Tagawa et al. 2005; Mrsic-Flogel et al.
2007) Arc mRNA is rapidly upregulated in visual cortical
neurons in layers 2–4 and 6 (there is very little Arc
expressed in layer 5) following brief (30 min) exposure
of one eye to visual stimulation (Tagawa et al. 2005; Syken
et al. 2006). Thus Arc signal reports functional activation
of cortical neurons following visual stimulation. As
compared with other activity regulated genes, such as cfos
and BDNF, Arc is useful because its basal expression is low
and because it is highly upregulated after only 30 min of
visual stimulation, yielding a large reliable signal (Tagawa
et al. 2005). For example, in cat visual cortex Arc mRNA
signal faithfully reports OD columns in normal animals
as well as OD shifts following MD (see Tagawa et al. 2005
Figs 1 and 4). The pattern of Arc mRNA induction reveals
the spatial extent and laminar distribution of cortical
neurons receiving functional input from the stimulated
eye. In normally reared mice, stimulation of the ipsilateral
eye induces Arc mRNA in an area coinciding with the BZ
(Tagawa et al. 2005; Syken et al. 2006) (labelled ‘Arc’ in
Fig. 1A). In addition OD shifts in mouse reported with
Arc induction following MD and ME similar in that both
report an expansion of the open eye territory (see Tagawa
et al. 2005 Fig. 3A and C).
2861
expansion of the area of visual cortical neurons that is
functionally driven by the remaining eye. This expansion
of open eye territory is a measure of OD plasticity. In
marked contrast, following ME in GAD65KO mice, no
expansion could be detected using the Arc induction
method (Fig. 1B and C). Since the Arc induction method
also permits an evaluation of the full spatial extent of
OD plasticity, we see here an additional deficit in GAD65
KO mice using Arc induction as compared to physiological recordings. In WT animals following ME, the
representation of the open eye expands to activate neurons
also located in the monocular zone (Fig. 1B). In contrast,
in GAD65KO, the ipsilateral (open) eye fails to activate
neurons located in MZ even though this cortical territory
was exclusively activated by the contralateral (removed)
Absent OD plasticity in GAD65 KO mice can be
rescued by diazepam
We first compared the representation of the ipsilateral eye
within the BZ of normally reared (NR) wild-type (WT)
and GAD65KO (KO) mice by measuring the width of
Arc mRNA induction. In the hemisphere ipsilateral to the
stimulated eye of NR animals at P35, Arc induction was
restricted to the BZ and was similar in width in GAD65KO
and WT animals (Fig. 1B and C). We quantified the size
of the BZ by making serial line scans through layer 4
across visual cortex (Tagawa et al. 2005; Syken et al. 2006).
The width was identical in GAD65KO and WT animals
(P = 0.6) (Fig. 1B and C). This observation suggests that
initial formation and refinement of the BZ (Tagawa et al.
2005) does not depend on levels of inhibition, consistent
with physiological observations (Hensch et al. 1998).
Arc induction was then used to assess OD plasticity in
GAD65KO and WT visual cortex at P35/36 after removing
the contralateral eye during the critical period at P25.
As expected (Tagawa et al. 2005; Syken et al. 2006), in
WT mice, there was a larger than normal representation
of the ipsilateral (remaining) eye after ME, reflecting an
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
Figure 2. GABA A α1 receptor subunit levels are reduced in
GAD65KO and are not rescued by diazepam
A, GABA A α1 receptor subunit mRNA levels in visual cortex of at P28
are lower in KO than WT (n = 8 and n = 6, respectively, P = 0.0068).
Y-axis is normalized scale for RT-qPCR. Four days’ application of
diazepam (KO+DZ) does not increase the mRNA levels to WT levels
(n = 7, P = 0.33). Plotted are means ± S.E.M. B, GABA A α3 receptor
subunit mRNA levels in visual cortex at P28 are similar in KO and WT
(n = 8 and n = 5 respectively, P = 0.36) (Y-axis is normalized scale for
RT-qPCR). Four days’ application of diazepam (KO+DZ) does not
change the mRNA levels from KO levels (n = 7, P = 0.53). C, GABA A
α1 protein levels measured with Western blots. Shown are lanes from
the same blot probed with anti-GABA A α1 and anti-ERK antibodies in
2 paired conditions: WT vs. KO as (upper) and WT vs. KO+DZ (4 days’
application of diazepam). D, protein levels (measured using
quantitative Western blots) are lower in KO than WT (61 ± 41% of
WT; n = 18 and n = 22, P = 0.016). Four days’ application of diazepam
(KO+DZ) does not increase protein levels from KO levels (77 ± 34% of
WT; n = 14 WT, n = 13 KO, compared to KO; P = 0.27). Protein levels
were normalized to average WT level in each comparison.
2862
P. O. Kanold and others
eye (Tagawa et al. 2005). This observation indicates
that there is an absence of OD plasticity in GAD65KO
mice, and mirrors the physiologically assessed defects in
OD plasticity in the BZ of these mice (Hensch et al.
1998). Thus, even though ME creates a stronger interocular activity imbalance and larger OD shifts than MD
(Tagawa et al. 2005), the lack of open eye expansion in
the GAD65KO visual cortex indicates a profound lack
of OD plasticity as previously reported (Hensch et al.
1998). Together these results imply that GAD65KO mice
Figure 3. NR2A receptor subunit levels are reduced in
GAD65KO, altering the NR2A/2B ratio
A, NR2A mRNA levels at P28 are lower in KO than WT (75 ± 26% of
WT; n = 17 and n = 16, P = 0.027), while NR2B levels are similar in WT
and KO (92 ± 23% of WT; n = 17 and n = 16, respectively, P = 0.34).
Thus the NR2A/NR2B ratio is decreased in KO compared to WT
(82 ± 19% of WT; P = 0.0068). Y-axis is normalized scale for
RT-qPCR. B, quantitative Western blots using anti-NR2A, anti-NR2B
and anti-ERK antibodies. Shown are adjacent lanes from the same
blot. Note the fainter band in the top lane indicating lower NR2A
levels in KO. C, quantification shows that NR2A protein levels are
significantly lower in KO than WT (50 ± 37% of WT; n = 19 and
n = 20, P = 0.00093). NR2B levels are slightly reduced (76 ± 33%)
(n = 21 and n = 22, P = 0.02). Thus, the NR2A/NR2B ratio is decreased
in KO compared to WT (P = 0.03). D, whole-cell patch recordings of
NMDA EPSCs from layer 4 neurons following white matter stimulation
in KO and WT animals. Traces are normalized to the peak. Note the
slower decay of the current from neuron in KO animal. The decay time
constants were slower in cells from KO animals than WT (KO:
190 ± 88 ms n = 15 cells vs. WT: 121 ± 58 ms, n = 9 cells; P = 0.014).
J Physiol 587.12
have normal developmental refinement of thalamocortical
connections but lack OD plasticity during the critical
period.
Application of diazepam is able to rescue OD plasticity
in the BZ as assessed using microelectrode recordings
(Hensch et al. 1998). We next tested if similar applications
of diazepam in GAD65KO mice can restore the expansion
of Arc induction in layer 4 by the open eye to close
to WT levels. As expected, diazepam application was
able to rescue the expansion of the open eye following
ME (Fig. 1B and C). Together these findings using Arc
induction replicate all aspects of the reported OD plasticity
phenotypes of GAD65KO mice seen with physiological
recordings (Hensch et al. 1998) and extend them by
providing spatial information on changes in ocularity.
Figure 4. Diazepam application rescues NR2A receptor subunit
levels and NR2A/2B ratio in GAD65KO
A, NR2A mRNA levels at P28 after 4 days’ diazepam is similar in KO
and WT (101 ± 44% of WT; n = 18 and n = 15, P = 0.97) and thus
increased from unmanipulated KO (Fig. 3A; P = 0.053). In contrast,
NR2B levels are unchanged (79 ± 27% of WT; n = 18 and n = 16,
respectively, P = 0.36). Thus after diazepam the NR2A/NR2B ratio is
increased to unmanipulated KO (compare to Fig. 3A; P = 0.0087) and
now similar in KO and WT (P = 0.4). B, quantitative Western blots
using anti-NR2A, anti-NR2B and ERK after diazepam. Shown are
adjacent lanes from the same blot. C, quantification shows that NR2A
protein levels are increased and now similar in KO and WT
(102 ± 27% of WT; n = 15 and n = 16, P = 0.86 vs. WT, P = 0.00009
vs. KO). NR2B levels are also slightly increased (118 ± 56% of WT;
n = 6 and n = 7, P = 0.46 vs. WT, P = 0.16 vs. KO). Together these
changes result in the NR2A/NR2B ratio being similar in KO and WT
(P = 0.52).
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
J Physiol 587.12
NMDA receptors and OD plasticity in GAD65KO mice
Diazepam fails to rescue GABA A receptor levels
Based in part on studies of the GAD65KO mice, it has
been proposed that there is an inhibitory threshold for
OD plasticity (Fagiolini & Hensch, 2000; Hensch, 2004).
In addition to GABA release, the levels and subtypes
of GABA receptors determine the amount of inhibition.
During development α1 is normally upregulated and α3
is downregulated (Chen et al. 2001). To test the inhibitory
threshold hypothesis directly, we therefore measured
mRNA levels of the GABA A α1 and α3 subunits in visual
cortex of GAD65KO mice and WT littermates at the peak
of the critical period (P28) using RT-qPCR. GABA A -α1
mRNA levels were lower (57 ± 26% of WT P = 0.0068) in
KO than in WT mice (Fig. 2A). Levels of the α3 subunit
were similar between KO and WT (Fig. 2B, 82 ± 37%,
P = 0.36). We confirmed the decreased expression of
GABA A -α1 at the protein level by Western blotting
(Fig. 2B,C). Since GABA A -α1 is upregulated by P28 during
normal development (Chen et al. 2001), these data suggest
that inhibition in GAD65KO mice remains in an immature
state.
Diazepam application rescues OD plasticity in
GAD65KO mice and sets into motion a developmental
process leading to the opening of the critical period
(Hensch et al. 1998) (Fig. 1B and C). Thus, if diazepam
initiates the maturation of inhibitory circuits, such an
effect should be detectable as a rescue of the expression
levels of the GABA A receptors. However, diazepam
application did not significantly increase the levels of
GABA A -α1 either at the mRNA or at the protein levels
(Fig. 2). In addition, no change in GABA α3 mRNA levels
were detected following diazepam (Fig. 2B). Thus, while
diazepam rescues OD plasticity, it apparently does not
lead to maturation of inhibition, at least as reflected in
GABA A -α1 or α3 levels.
Altered NMDA receptor levels are rescued by
diazepam in GAD65 KO
Cortical circuits maintain a balance of inhibition and
excitation, and equilibrium is maintained via homeostatic plasticity mechanisms (Turrigiano, 1999). These
homeostatic mechanisms predict that a reduction in
inhibition would be mirrored by a reduction in excitation.
Since inhibition in GAD65KO mice is immature, we
examined if excitation is also affected by genetic removal
of GAD65. In layer 4, the site of thalamocortical
projections, NMDA-mediated responses are strongest in
early development (Tsumoto et al. 1987; Fox et al. 1989;
Lu et al. 2001). Thus we investigated if the expression
levels of NMDA receptor subunits are altered in GAD65KO
mice. Quantitative RT-PCR analysis revealed that the
mRNA levels of the NR2A subunit at P28 were reduced
in GAD65KO vs. WT mice, while levels of NR2B were
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
2863
similar between the two genotypes (Fig. 3A). Thus the
ratio of NR2A/NR2B is reduced in GAD65KO mice. This
reduction was confirmed in Western blots to assess protein
levels (Fig. 3B and C). Since the ratio of NR2A/NR2B
determines the decay kinetics of NMDA currents, we
further confirmed these data by electrophysiological
recordings from layer 4 neurons. White matter stimulation
evoked NMDA-EPSCs with significantly longer decay
times in GAD65KO mice than in WT mice (Fig. 3D),
consistent with the observed reduction in the NR2A/NR2B
ratio. Together these data show that the functional
properties of NMDA receptors are altered in GAD65KO
mice due at least in part to reduced expression level
of NR2A. The lower than normal NR2A/NR2B ratio in
GAD65KO mice is consistent with an immature expression
pattern of NMDA receptor subunits. In addition, reduced
NR2A levels are consistent with the reported deficiency in
LTD in GAD65KO mice (Choi et al. 2002).
Because diazepam application rescues OD plasticity as
well as LTD in GAD65KO mice (Hensch et al. 1998; Choi
et al. 2002), we hypothesized that diazepam application
would rescue the alterations in NMDA receptor levels.
We therefore tested the effects of diazepam application
on the expression levels of NR2A and NR2B in GAD65
KO. Diazepam application increased NR2A mRNA, but
not NR2B mRNA levels, thus restoring the NR2A/NR2B
ratio to close to WT (Fig. 4A). Similar changes were
seen in protein levels using quantitative Western blots
(Fig. 4B and C). These findings together indicate that
diazepam application is able to restore the levels of NR2A
to wild-type levels. Together these results demonstrate that
the function of NMDA receptors is profoundly altered in
GAD65KO mice and that application of diazepam rescues
these changes to WT.
Discussion
Our results confirm that GAD65KO mice lack OD
plasticity and that application of diazepam can rescue
the genetic defect in OD plasticity (Hensch et al. 1998).
Here we find that GAD65KO mice not only have altered
inhibition, as assessed by examining GABA A receptor subunit composition, but also have alterations in NMDA
receptor subunit composition and function. A major
finding of this study is that the expected restoration of
OD plasticity in GAD65KO mice with diazepam treatment
during the critical period unexpectedly rescues the NR2A
to NR2B ratio to WT but not GABA A receptor subunit
composition.
Arc induction faithfully reports OD plasticity in WT
and GAD65KO mice
In GAD65KO mice, OD plasticity is absent, as
demonstrated here by the failure of visual stimulation
through the ipsilateral (open) eye to induce an expansion
2864
P. O. Kanold and others
of Arc mRNA expression into cortical territory normally
activated only by the contralateral (deprived) eye (the MZ,
Fig. 1A). In WT mice following unilateral eye removal,
neurons located in cortical areas visually driven by
the contralateral eye (as assessed by induction of Arc
mRNA) now acquire robust Arc mRNA induction with
stimulation of the ipsilateral NDE. Thus the cortical
representation of the NDE expands following ME; this
is both a functional and a spatial measure of OD plasticity.
Many prior experiments beginning with the original
experiments of Hubel and Wiesel (Wiesel & Hubel,
1963) have measured OD plasticity electrophysiologically
by assessing the change in response bias of binocular
neurons. Following MD of the dominant (contralateral)
eye in WT mice, neurons within the BZ increase the
strength of response to the ipsilateral NDE, which is
also a reflection of OD plasticity (e.g. Hensch et al.
1998). Each method provides a functional assessment
of OD plasticity in the sense that cortical neurons are
driven to spike or to upregulate Arc mRNA as a result
of visual stimulation, but the information provided by
each method is complementary. Arc induction allows
spatial mapping of individual neurons located in cortical
territory responsive to the NDE; as such it is similar but
not identical to transneuronal labelling experiments which
also provide anatomical information about plasticity of
geniculocortical axons (Hubel et al. 1977). In contrast
single unit electrophysiological recordings measure the
strength of visually driven responses of neurons at one
location in the BZ and in and of themselves cannot provide
extensive spatial information. Both methods – Arc mRNA
induction and electrophysiology – report an absence
of OD plasticity in GAD65KO mice. Moreover, as we
observe here, diazepam application in GAD65KO restores
the deprivation-induced expansion of Arc induction in
cortical neurons located in the MZ following NDE
stimulation. This expansion is a measure of recovery
of OD plasticity similar to the recovery of the electrophysiologically measured OD shift in GAD65KO mice
after diazepam application (Hensch et al. 1998). Thus,
both methods of measuring OD plasticity yield similar
conclusions. In addition, we can further conclude that
GAD65KO mice have two related deficits in OD plasticity,
both of which can be rescued with diazepam: a failure
of inputs driven by the NDE to strengthen on cortical
neurons located within the BZ (Hensch et al. 1998) as
well as an absence of expansion in the spatial extent of
cortical territory responding to stimulation of the NDE,
as demonstrated here using Arc induction.
NR2A/2B ratio is correlated with OD plasticity
in GAD65KO mice
The composition of NMDA receptors has been linked to
plasticity during the critical period. In particular it has
J Physiol 587.12
been suggested that the shift in the ratio of receptors
containing NR2A versus NR2B subunit is associated with
the ability of visual cortex to support OD plasticity
(Philpot et al. 2003; Malenka & Bear, 2004). Early in
development there are more NR2B containing receptors,
and with ensuing development the levels of both NR2A
and NR2B increase (Quinlan et al. 1999a; Erisir & Harris,
2003; Liu et al. 2004b). However during the critical
period there appears to there is a marked increase in
the NR2A/NR2B ratio especially in layer 4 (Erisir &
Harris, 2003; Liu et al. 2004b). This change in NMDA
receptor subunit composition is paralleled by a maturation
of inhibitory circuits (Golshani et al. 1997; Chen et al.
2001; Bosman et al. 2002; Jiang et al. 2005). Thus, it is
possible that the maturation of inhibition and excitation
are co-regulated to ensure optimal network function. If so,
then a deficit in maturation of inhibition such as occurs in
GAD65KO mice could also alter maturation of excitation
as manifested in altered NMDA receptor composition in
the KO mice. In addition, it may be that the presence of
immature inhibition coupled with an immature NR2A/2B
ratio sets a scene for diazepam to enhance OD plasticity.
This idea is consistent with the fact that in WT animals
diazepam enhances OD plasticity before but not during
the critical period (Fagiolini & Hensch, 2000), at a time
when both inhibition and NR2A/2B ratios are immature
(Quinlan et al. 1999a; Erisir & Harris, 2003; Liu et al.
2004b).
Altered NR2A/2B ratios are thought to alter the balance
between LTD and LTP (Yoshimura et al. 2003; Liu et al.
2004a; Massey et al. 2004; Bartlett et al. 2007; Philpot et al.
2007). OD plasticity – the shift in strength of functional
inputs driven by the two eyes – requires weakening of
inputs from the closed eye and strengthening of inputs
from the open eye (Quinlan et al. 1999b; Bear, 2003;
Philpot et al. 2003, 2007). It has been proposed that
these cellular mechanisms of OD plasticity involve forms
of LTP and LTD (Hensch, 2004; Fox & Wong, 2005;
Philpot et al. 2007). It is conceivable that the OD deficits
in GAD65KO are associated with deficits in LTP and/or
LTD. Unfortunately, there is conflicting evidence regarding
alterations in of synaptic plasticity in GAD65KO mice.
Initial characterization of the GAD65KO reported intact
LTP and LTD (Hensch et al. 1998). In contrast, recent
studies have revealed LTD deficiencies in GAD65KO (Choi
et al. 2002). Moreover, these deficiencies were rescued by
diazepam treatment (Choi et al. 2002). Our observation
of an altered ratio of NR2A/NR2B in GAD65KO mice,
and the rescue of the ratio to WT by diazepam, partially
resolves this conflict and both findings in our study are
consistent with reduced OD plasticity plus reduced LTD
in GAD65KO. Our data show altered decay kinetics in layer
4 neurons consequent to thalamocortical stimulation,
consistent with the alteration in LTD reported at layer
4 to layer 2/3 synapses (Choi et al. 2002). Thus it is likely
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
J Physiol 587.12
NMDA receptors and OD plasticity in GAD65KO mice
that similar changes and the consequent rescue effects of
diazepam on NMDA ratios affect neurons in all cortical
layers. However, because the qPCR and Western blots
analyses were preformed in homogenates from all cortical
layers, we cannot separate layer specific effects here and
conclude that diazepam rescues OD plasticity by rescuing
NMDA ratios in all layers.
Co-regulation of excitation, inhibition
and OD plasticity
The lowered levels of NR2A in of the context of decreased
GABA release in GAD65KO suggest that inhibitory and
excitatory circuit function is co-regulated. Homeostatic
plasticity of synapses prevents large increases in network
activity levels consequent to reduced network activity
(Turrigiano, 1999). Such homeostatic mechanisms might
be engaged when GABA release at synapses is decreased
as in the genetic removal of GAD65. These homeostatic mechanisms might prevent the developmental
upregulation of NR2A, and lead to lower NR2A levels
during the critical period. Thus impaired or immature
inhibition in GADKO mice could also prevent normal
maturation of excitatory circuits. Application of diazepam,
by increasing the strength of GABAergic inhibition, might
then engage homeostatic mechanisms and increase the
expression and availability of NR2A containing receptors.
This additional availability of NR2A containing receptors
could then enable OD plasticity via intact mechanisms of
LTD. This scenario would help reconcile divergent views
on mechanisms of OD plasticity that argue for the critical
role of inhibition on the one hand (Hensch, 2004), or for
a key requirement for NMDA receptor function on the
other (Philpot et al. 2007). Our findings are consistent
with the idea that the onset of the critical period may
not be ‘triggered by an inhibitory threshold’ so much as
that it occurs as both inhibitory and excitatory synapses
are scaled up via homeostatic mechanisms to reach a
balanced threshold. Consequently, any perturbation that
alters maturation of excitation or inhibition would be
expected to alter the onset of the critical period. In this
scenario, mechanisms that regulate activity-dependent
homeostatic synaptic adjustments would be inextricably
linked to those that regulate ocular dominance
plasticity.
References
Antonini A, Fagiolini M & Stryker MP (1999). Anatomical
correlates of functional plasticity in mouse visual cortex. J
Neurosci 19, 4388–4406.
Antonini A & Stryker MP (1993). Rapid remodeling of axonal
arbors in the visual cortex. Science 260, 1819–1821.
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
2865
Bartlett TE, Bannister NJ, Collett VJ, Dargan SL, Massey PV,
Bortolotto ZA, Fitzjohn SM, Bashir ZI, Collingridge GL &
Lodge D (2007). Differential roles of NR2A and
NR2B-containing NMDA receptors in LTP and LTD in the
CA1 region of two-week old rat hippocampus.
Neuropharmacology 52, 60–70.
Bear MF (2003). Bidirectional synaptic plasticity: from theory
to reality. Philos Trans R Soc Lond B Biol Sci 358, 649–655.
Bear MF & Rittenhouse CD (1999). Molecular basis for
induction of ocular dominance plasticity. J Neurobiol 41,
83–91.
Bosman LW, Rosahl TW & Brussaard AB (2002). Neonatal
development of the rat visual cortex: synaptic function of
GABA A receptor α subunits. J Physiol 545, 169–181.
Cang J, Renteria RC, Kaneko M, Liu X, Copenhagen DR &
Stryker MP (2005). Development of precise maps in visual
cortex requires patterned spontaneous activity in the retina.
Neuron 48, 797–809.
Carmignoto G & Vicini S (1992). Activity-dependent decrease
in NMDA receptor responses during development of the
visual cortex. Science 258, 1007–1011.
Chapman B, Jacobson MD, Reiter HO, Stryker, MP (1986).
Ocular dominance shift in kitten visual cortex caused by
imbalance in retinal electrical activity. Nature 324, 154–156.
Chen L, Yang C & Mower GD (2001). Developmental changes
in the expression of GABA A receptor subunits (α 1 , α 2 , α 3 ) in
the cat visual cortex and the effects of dark rearing. Brain Res
Mol Brain Res 88, 135–143.
Choi SY, Morales B, Lee HK & Kirkwood A (2002). Absence of
long-term depression in the visual cortex of glutamic Acid
decarboxylase-65 knock-out mice. J Neurosci 22,
5271–5276.
Erisir A & Harris JL (2003). Decline of the critical period of
visual plasticity is concurrent with the reduction of NR2B
subunit of the synaptic NMDA receptor in layer 4. J Neurosci
23, 5208–5218.
Fagiolini M, Fritschy JM, Low K, Mohler H, Rudolph U &
Hensch TK (2004). Specific GABA A circuits for visual
cortical plasticity. Science 303, 1681–1683.
Fagiolini M & Hensch TK (2000). Inhibitory threshold for
critical-period activation in primary visual cortex. Nature
404, 183–186.
Fox K, Sato H & Daw N (1989). The location and function of
NMDA receptors in cat and kitten visual cortex. J Neurosci 9,
2443–2454.
Fox K & Wong RO (2005). A comparison of experiencedependent plasticity in the visual and somatosensory
systems. Neuron 48, 465–477.
Frenkel MY & Bear MF (2004). How monocular deprivation
shifts ocular dominance in visual cortex of young mice.
Neuron 44, 917–923.
Golshani P, Truong H & Jones EG (1997). Developmental
expression of GABA A receptor subunit and GAD genes in
mouse somatosensory barrel cortex. J Comp Neurol 383,
199–219.
Hanover JL, Huang ZJ, Tonegawa S & Stryker MP (1999).
Brain-derived neurotrophic factor overexpression induces
precocious critical period in mouse visual cortex. J Neurosci
19, RC40.
2866
P. O. Kanold and others
Hensch TK (2004). Critical period regulation. Annu Rev
Neurosci 27, 549–579.
Hensch TK, Fagiolini M, Mataga N, Stryker MP, Baekkeskov S
& Kash SF (1998). Local GABA circuit control of
experience-dependent plasticity in developing visual cortex.
Science 282, 1504–1508.
Huang ZJ, Kirkwood A, Pizzorusso T, Porciatti V, Morales B,
Bear MF, Maffei L & Tonegawa S (1999). BDNF regulates the
maturation of inhibition and the critical period of plasticity
in mouse visual cortex. Cell 98, 739–755.
Hubel DH & Wiesel TN (1969). Anatomical demonstration of
columns in the monkey striate cortex. Nature 221, 747–750.
Hubel DH, Wiesel TN & LeVay S (1977). Plasticity of ocular
dominance columns in monkey striate cortex. Philos Trans R
Soc Lond B Biol Sci 278, 377–409.
Hubener M (2003). Mouse visual cortex. Curr Opin Neurobiol
13, 413–420.
Huopaniemi L, Keist R, Randolph A, Certa U & Rudolph U
(2004). Diazepam-induced adaptive plasticity revealed by α 1
GABA A receptor-specific expression profiling. J Neurochem
88, 1059–1067.
Jiang B, Huang ZJ, Morales B & Kirkwood A (2005).
Maturation of GABAergic transmission and the timing of
plasticity in visual cortex. Brain Res Brain Res Rev 50,
126–133.
Kanold PO, Kara P, Reid RC & Shatz CJ (2003). Role of
subplate neurons in functional maturation of visual cortical
columns. Science 301, 521–525.
Kanold PO & Shatz CJ (2006). Subplate neurons regulate
maturation of cortical inhibition and outcome of ocular
dominance plasticity. Neuron 51, 627–638.
Katagiri H, Fagiolini M & Hensch TK (2007). Optimization of
somatic inhibition at critical period onset in mouse visual
cortex. Neuron 53, 805–812.
Kirkwood A & Bear MF (1994). Hebbian synapses in visual
cortex. J Neurosci 14, 1634–1645.
Kirkwood A & Bear MF (1995). Elementary forms of synaptic
plasticity in the visual cortex. Biol Res 28, 73–80.
Kirkwood A, Lee HK & Bear MF (1995). Co-regulation of
long-term potentiation and experience-dependent synaptic
plasticity in visual cortex by age and experience. Nature 375,
328–331.
Klausberger T, Roberts JD & Somogyi P (2002). Cell type- and
input-specific differences in the number and subtypes of
synaptic GABA A receptors in the hippocampus. J Neurosci
22, 2513–2521.
Liu L, Wong TP, Pozza MF, Lingenhoehl K, Wang Y, Sheng M,
Auberson YP & Wang YT (2004a). Role of NMDA receptor
subtypes in governing the direction of hippocampal synaptic
plasticity. Science 304, 1021–1024.
Liu XB, Murray KD & Jones EG (2004b). Switching of NMDA
receptor 2A and 2B subunits at thalamic and cortical
synapses during early postnatal development. J Neurosci 24,
8885–8895.
Lu HC, Gonzalez E & Crair MC (2001). Barrel cortex critical
period plasticity is independent of changes in NMDA
receptor subunit composition. Neuron 32, 619–634.
Malenka RC & Bear MF (2004). LTP and LTD: an
embarrassment of riches. Neuron 44, 5–21.
J Physiol 587.12
Massey PV, Johnson BE, Moult PR, Auberson YP, Brown MW,
Molnar E, Collingridge GL & Bashir ZI (2004). Differential
roles of NR2A and NR2B-containing NMDA receptors in
cortical long-term potentiation and long-term depression. J
Neurosci 24, 7821–7828.
Morales B, Choi SY & Kirkwood A (2002). Dark rearing alters
the development of GABAergic transmission in visual cortex.
J Neurosci 22, 8084–8090.
Mrsic-Flogel TD, Hofer SB, Ohki K, Reid RC, Bonhoeffer T &
Hubener M (2007). Homeostatic regulation of eye-specific
responses in visual cortex during ocular dominance
plasticity. Neuron 54, 961–972.
Niell CM & Stryker MP (2008). Highly selective receptive fields
in mouse visual cortex. J Neurosci 28, 7520–7536.
Pham TA, Graham SJ, Suzuki S, Barco A, Kandel ER, Gordon
B, Lickey ME (2004). A semi-persistent adult ocular
dominance plasticity in visual cortex is stabilized by
activated CREB. Learn Mem 11, 738–47
Philpot BD, Cho KK & Bear MF (2007). Obligatory role of
NR2A for metaplasticity in visual cortex. Neuron 53,
495–502.
Philpot BD, Espinosa JS & Bear MF (2003). Evidence for
altered NMDA receptor function as a basis for metaplasticity
in visual cortex. J Neurosci 23, 5583–5588.
Philpot BD, Sekhar AK, Shouval HZ & Bear MF (2001). Visual
experience and deprivation bidirectionally modify the
composition and function of NMDA receptors in visual
cortex. Neuron 29, 157–169.
Quinlan EM, Olstein DH & Bear MF (1999a). Bidirectional,
experience-dependent regulation of N-methyl-D-aspartate
receptor subunit composition in the rat visual cortex during
postnatal development. Proc Natl Acad Sci U S A 96,
12876–12880.
Quinlan EM, Philpot BD, Huganir RL & Bear MF (1999b).
Rapid, experience-dependent expression of synaptic NMDA
receptors in visual cortex in vivo. Nat Neurosci 2, 352–357.
Roberts EB & Ramoa AS (1999). Enhanced NR2A subunit
expression and decreased NMDA receptor decay time at the
onset of ocular dominance plasticity in the ferret. J
Neurophysiol 81, 2587–2591.
Sawtell NB, Frenkel MY, Philpot BD, Nakazawa K, Tonegawa S
& Bear MF (2003). NMDA receptor-dependent ocular
dominance plasticity in adult visual cortex. Neuron 38,
977–985.
Shatz CJ & Stryker MP (1978). Ocular dominance in layer IV of
the cat’s visual cortex and the effects of monocular
deprivation. J Physiol 281, 267–83.
Syken J, Grandpre T, Kanold PO & Shatz CJ (2006). PirB
restricts ocular-dominance plasticity in visual cortex. Science
313, 1795–1800.
Tagawa Y, Kanold PO, Majdan M & Shatz CJ (2005). Multiple
periods of functional ocular dominance plasticity in mouse
visual cortex. Nat Neurosci 8, 380–388.
Tsumoto T, Hagihara K, Sato H & Hata Y (1987). NMDA
receptors in the visual cortex of young kittens are more
effective than those of adult cats. Nature 327, 513–514.
Turrigiano GG (1999). Homeostatic plasticity in neuronal
networks: the more things change, the more they stay the
same. Trends Neurosci 22, 221–227.
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
J Physiol 587.12
NMDA receptors and OD plasticity in GAD65KO mice
Wiesel TN & Hubel DH (1963). Single-cell responses in striate
cortex of kittens deprived of vision in one eye. J Neurophysiol
26, 1003–1017.
Wiesel TN, Hubel DH & Lam DM (1974). Autoradiographic
demonstration of ocular-dominance columns in the monkey
striate cortex by means of transneuronal transport. Brain Res
79, 273–279.
Yoshimura Y, Ohmura T & Komatsu Y (2003). Two forms of
synaptic plasticity with distinct dependence on age,
experience, and NMDA receptor subtype in rat visual cortex.
J Neurosci 23, 6557–6566.
2867
Acknowledgements
We thank M. Marcotrigiano and B. Printseva for technical
assistance and Shatz and Kanold lab members for helpful
discussions. This work was supported by National Institute of
Health grants to C.J.S. (NEI R01 EY02858) and P.O.K. (NEI F32
EY13526).
Author contributions
P.O.K. and C.J.S. conceived the study. P.O.K., Y.K. and T.G.
performed experiments and analyzed data. P.O.K. and C.J.S.
wrote the manuscript.
C 2009 The Authors. Journal compilation C 2009 The Physiological Society
Author’s present address
T. GrandPre: Baylor College of Medicine, One Baylor Plaza,
MS411, Houston, TX 77030, USA.